Transcript: Human XM_005261721.4

PREDICTED: Homo sapiens somatostatin receptor 3 (SSTR3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSTR3 (6753)
Length:
3648
CDS:
82..1338

Additional Resources:

NCBI RefSeq record:
XM_005261721.4
NBCI Gene record:
SSTR3 (6753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261721.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356479 TTCAGTCACCAACGTCTACAT pLKO_005 309 CDS 100% 4.950 6.930 N SSTR3 n/a
2 TRCN0000356480 GGCCTGGACTTTGATGCTATT pLKO_005 1442 3UTR 100% 10.800 7.560 N SSTR3 n/a
3 TRCN0000014390 ACGACCTCAGAACCTGAGAAT pLKO.1 112 CDS 100% 4.950 3.465 N SSTR3 n/a
4 TRCN0000014392 GCCCTTCTACGTGCTCAACAT pLKO.1 894 CDS 100% 4.950 3.465 N SSTR3 n/a
5 TRCN0000356554 TGCCCTTCTACGTGCTCAACA pLKO_005 893 CDS 100% 4.950 3.465 N SSTR3 n/a
6 TRCN0000014391 GATGCGCATCAGCTACCTGTA pLKO.1 1317 CDS 100% 4.050 2.835 N SSTR3 n/a
7 TRCN0000356477 GTAGGTTGCTTCTACTCTCTG pLKO_005 1491 3UTR 100% 4.050 2.835 N SSTR3 n/a
8 TRCN0000014389 GCCTGCCTTCTTTGGGCTCTA pLKO.1 945 CDS 100% 1.350 0.945 N SSTR3 n/a
9 TRCN0000014388 TCTACTCTCTGGGCCTTGTTT pLKO.1 1501 3UTR 100% 5.625 3.375 N SSTR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261721.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491955 CGAATGCTTAAAGCGTTGAGTACA pLX_317 29.3% 99.6% 99.7% V5 (many diffs) n/a
2 TRCN0000489462 ATATGCCCAGCCTCCCGTTAATTA pLX_317 22.2% 99.6% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV