Transcript: Mouse NM_009218.3

Mus musculus somatostatin receptor 3 (Sstr3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sstr3 (20607)
Length:
3928
CDS:
398..1684

Additional Resources:

NCBI RefSeq record:
NM_009218.3
NBCI Gene record:
Sstr3 (20607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009218.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000453053 GCACACTGAGCCATCTGTAAG pLKO_005 1665 CDS 100% 10.800 15.120 N Sstr3 n/a
2 TRCN0000451949 GACTCAGGGATGGGTAAACTG pLKO_005 1946 3UTR 100% 4.950 6.930 N Sstr3 n/a
3 TRCN0000220286 CTAAGACCATCACGTCGCATT pLKO.1 1409 CDS 100% 4.050 5.670 N Sstr3 n/a
4 TRCN0000220284 GCCTTTCTATCTGCTCAACAT pLKO.1 1237 CDS 100% 4.950 3.465 N Sstr3 n/a
5 TRCN0000220287 GACCAGTGTCTATATCCTCAA pLKO.1 634 CDS 100% 4.050 2.835 N Sstr3 n/a
6 TRCN0000220288 TGCTACTTGCTCATTGTGGTA pLKO.1 1073 CDS 100% 2.640 1.848 N Sstr3 n/a
7 TRCN0000220285 CAACCAGTTCACCAGCATCTT pLKO.1 775 CDS 100% 4.950 2.970 N Sstr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009218.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491955 CGAATGCTTAAAGCGTTGAGTACA pLX_317 29.3% 82.1% 83% V5 (many diffs) n/a
2 TRCN0000489462 ATATGCCCAGCCTCCCGTTAATTA pLX_317 22.2% 82.2% 83.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV