Construct: ORF TRCN0000489536
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019467.1_s317c1
- DNA Barcode:
- TACCCCGAACATCAAACAACACCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- P2RY6 (5031)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489536
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277204.1 | 99.8% | 99.6% | 984_985insG |
| 2 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277205.1 | 99.8% | 99.6% | 984_985insG |
| 3 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277206.1 | 99.8% | 99.6% | 984_985insG |
| 4 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277207.1 | 99.8% | 99.6% | 984_985insG |
| 5 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176796.2 | 99.8% | 99.6% | 984_985insG |
| 6 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176797.2 | 99.8% | 99.6% | 984_985insG |
| 7 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176798.2 | 99.8% | 99.6% | 984_985insG |
| 8 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_005274022.3 | 99.8% | 99.6% | 984_985insG |
| 9 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_006718571.3 | 99.8% | 99.6% | 984_985insG |
| 10 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545077.2 | 99.8% | 99.6% | 984_985insG |
| 11 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545079.2 | 99.8% | 99.6% | 984_985insG |
| 12 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545076.2 | 82.3% | 82.2% | 1_210del;1194_1195insG |
| 13 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277208.1 | 76.3% | 76.2% | 1_303del;1287_1288insG |
| 14 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | NM_183168.2 | 83.6% | 86.3% | (many diffs) |
| 15 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | XM_006507640.3 | 83.6% | 86.3% | (many diffs) |
| 16 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | XM_011241739.2 | 83.6% | 86.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1062
- ORF length:
- 987
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggaa tgggacaatg gcacaggcca ggctctgggc ttgccaccca 121 ccacctgtgt ctaccgcgag aacttcaagc aactgctgct gccacctgtg tattcggcgg 181 tgctggcggc tggcctgccg ctgaacatct gtgtcattac ccagatctgc acgtcccgcc 241 gggccctgac ccgcacggcc gtgtacaccc taaaccttgc tctggctgac ctgctatatg 301 cctgctccct gcccctgctc atctacaact atgcccaagg tgatcactgg ccctttggcg 361 acttcgcctg ccgcctggtc cgcttcctct tctatgccaa cctgcacggc agcatcctct 421 tcctcacctg catcagcttc cagcgctacc tgggcatctg ccacccgctg gccccctggc 481 acaaacgtgg gggccgccgg gctgcctggc tagtgtgtgt agccgtgtgg ctggccgtga 541 caacccagtg cctgcccaca gccatcttcg ctgccacagg catccagcgt aaccgcactg 601 tctgctatga cctcagcccg cctgccctgg ccacccacta tatgccctat ggcatggctc 661 tcactgtcat cggcttcctg ctgccctttg ctgccctgct ggcctgctac tgtctcctgg 721 cctgccgccT GTGCCGCCAG GATGGCCCGG CAGAGCCTGT GGCCCAGGAG CGGCGTGGCA 781 AGGCGGCCCG CATGGCCGTG GTGGTGGCTG CTGCCTTTGC CATCAGCTTC CTGCCTTTTC 841 ACATCACCAA GACAGCCTAC CTGGCAGTGC GCTCGACGCC GGGCGTCCCC TGCACTGTAT 901 TGGAGGCCTT TGCAGCGGCC TACAAAGGCA CGCGGCCGTT TGCCAGTGCC AACAGCGTGC 961 TGGACCCCAT CCTCTTCTAC TTCACCCAGA AGAAGTTCCG CCGGCGACCA CATGAGCTCC 1021 TACAGAAACT CACAGCCAAA TGGCAGAGGC AGGGTCGCGA CCCAGCTTTC TTGTACAAAG 1081 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1141 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1201 ACGATACCCC GAACATCAAA CAACACCAAC GCGTTAAGTC gacaatcaac ctctggatta 1261 caaaatttgt gaaagatt