Construct: ORF TRCN0000489546
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021850.1_s317c1
- DNA Barcode:
- CCGTCCCTATGTCACTGCTATTAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SKP2 (6502)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489546
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6502 | SKP2 | S-phase kinase associated p... | NM_005983.4 | 100% | 100% | |
| 2 | human | 6502 | SKP2 | S-phase kinase associated p... | NM_032637.4 | 87.5% | 82.2% | (many diffs) |
| 3 | human | 6502 | SKP2 | S-phase kinase associated p... | XM_011514082.3 | 84% | 83.4% | (many diffs) |
| 4 | human | 6502 | SKP2 | S-phase kinase associated p... | XR_001742203.2 | 74.8% | (many diffs) | |
| 5 | human | 6502 | SKP2 | S-phase kinase associated p... | XM_011514083.3 | 60.1% | 60.1% | 0_1ins507 |
| 6 | human | 6502 | SKP2 | S-phase kinase associated p... | NM_001243120.1 | 49.5% | 49.5% | 0_1ins507;29_30ins135 |
| 7 | human | 6502 | SKP2 | S-phase kinase associated p... | XM_017009753.1 | 49.2% | 44.3% | (many diffs) |
| 8 | mouse | 27401 | Skp2 | S-phase kinase-associated p... | NM_013787.3 | 85% | 86.3% | (many diffs) |
| 9 | mouse | 27401 | Skp2 | S-phase kinase-associated p... | XM_011245359.1 | 82.9% | 83.6% | (many diffs) |
| 10 | mouse | 27401 | Skp2 | S-phase kinase-associated p... | NM_001285980.1 | 77.3% | 78.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1341
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gcacaggaag cacctccagg agattccaga cctgagtagc aacgttgcca 121 ccagcttcac gtggggatgg gattccagca agacttctga actgctgtca ggcatggggg 181 tctccgccct ggagaaagag gagcccgaca gtgagaacat cccccaggaa ctgctctcaa 241 acctgggcca cccggagagc cccccacgga aacggctgaa gagcaaaggg agtgacaaag 301 actttgtgat tgtccgcagg cctaagctaa atcgagagaa ctttccaggt gtttcatggg 361 actcccttcc ggatgagctg ctcttgggaa tcttttcctg tctgtgcctc cctgagctgc 421 taaaggtctc tggtgtttgt aagaggtggt atcgcctagc gtctgatgag tctctatggc 481 agaccttaga cctcacaggt aaaaatctgc acccggatgt gactggtcgg ttgctgtctc 541 aaggggtgat tgccttccgc tgcccacgat catttatgga ccaaccattg gctgaacatt 601 tcagcccttt tcgtgtacag cacatggacc tatcgaactc agttatagaa gtgtccaccc 661 tccacggcat actgtctcag tgttccaagt tgcagaatct aagcctggaa ggcctgcggc 721 tttcggatcc cattgtcaat actctcgcaa aaaactcaaa tttagtgcga cttaaccttt 781 ctgggtgttc tggattctct gaatttgccc tgcagacttt gctaagcagc tgttccagac 841 tggatgagct gaacctctcc tggtgttttg atttcactga aaagcatgta caggtggctg 901 ttgcgcatgt gtcagagacc atcacccagc tgaatcttag cggctacaga aagaaTCTCC 961 AGAAATCAGA TCTCTCTACT TTAGTTAGAA GATGCCCCAA TCTTGTCCAT CTAGACTTAA 1021 GTGATAGTGT CATGCTAAAG AATGACTGCT TTCAGGAATT TTTCCAGCTC AACTACCTCC 1081 AACACCTATC ACTCAGTCGG TGCTATGATA TAATACCTGA AACTTTACTT GAACTTGGAG 1141 AAATTCCCAC ACTAAAAACA CTACAAGTTT TTGGAATCGT GCCAGATGGT ACCCTTCAAC 1201 TGTTAAAGGA AGCCCTTCCT CATCTACAGA TTAATTGCTC CCATTTCACC ACCATTGCCA 1261 GGCCAACTAT TGGCAACAAA AAGAACCAGG AGATATGGGG CATCAAATGC CGACTGACAC 1321 TGCAAAAGCC CAGTTGTCTA TAGAACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1381 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1441 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC CGTCCCTATG 1501 TCACTGCTAT TACACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1561 att