Construct: ORF TRCN0000489607
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021159.1_s317c1
- DNA Barcode:
- AAGCCAGCTCCCAATAGCAAACTT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- AVPR2 (554)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489607
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 554 | AVPR2 | arginine vasopressin recept... | NM_000054.6 | 99.9% | 100% | 927A>G |
| 2 | human | 554 | AVPR2 | arginine vasopressin recept... | NM_001146151.3 | 82.6% | 82.7% | (many diffs) |
| 3 | human | 554 | AVPR2 | arginine vasopressin recept... | NR_027419.2 | 51.4% | (many diffs) | |
| 4 | mouse | 12000 | Avpr2 | arginine vasopressin recept... | NM_019404.2 | 84% | 87.6% | (many diffs) |
| 5 | mouse | 12000 | Avpr2 | arginine vasopressin recept... | XM_006527756.3 | 84% | 87.6% | (many diffs) |
| 6 | mouse | 12000 | Avpr2 | arginine vasopressin recept... | XM_017318365.1 | 83.9% | 87.3% | (many diffs) |
| 7 | mouse | 12000 | Avpr2 | arginine vasopressin recept... | NM_001276299.1 | 35.7% | 37.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1185
- ORF length:
- 1113
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgctcatg gcgtccacca cttccgctgt gcctgggcat ccctctctgc 121 ccagcctgcc cagcaacagc agccaggaga ggccactgga cacccgggac ccgctgctag 181 cccgggcgga gctggcgctg ctctccatag tctttgtggc tgtggccctg agcaatggcc 241 tggtgctggc ggccctagct cggcggggcc ggcggggcca ctgggcaccc atacacgtct 301 tcattggcca cttgtgcctg gccgacctgg ccgtggctct gttccaagtg ctgccccagc 361 tggcctggaa ggccaccgac cgcttccgtg ggccagatgc cctgtgtcgg gccgtgaagt 421 atctgcagat ggtgggcatg tatgcctcct cctacatgat cctggccatg acgctggacc 481 gccaccgtgc catctgccgt cccatgctgg cgtaccgcca tggaagtggg gctcactgga 541 accggccggt gctagtggct tgggccttct cgctccttct cagcctgccc cagctcttca 601 tcttcgccca gcgcaacgtg gaaggtggca gcggggtcac tgactgctgg gcctgctttg 661 cggagccctg gggccgtcgc acctatgtca cctggattgc cctgatggtg ttcgtggcac 721 ctaccctggg tatcgccgcc tgccaggtgc tcatcttccg ggagattcat gccagtctgg 781 tgccagggCC ATCAGAGAGG CCTGGGGGGC GCCGCAGGGG ACGCCGGACA GGCAGCCCCG 841 GTGAGGGAGC CCACGTGTCA GCAGCTGTGG CCAAGACTGT GAGGATGACG CTAGTGATTG 901 TGGTCGTCTA TGTGCTGTGC TGGGCACCCT TCTTCCTGGT GCAGCTGTGG GCCGCGTGGG 961 ACCCGGAGGC ACCTCTGGAA GGGGCGCCCT TTGTGCTGCT CATGTTGCTG GCCAGCCTCA 1021 ACAGCTGCAC CAACCCCTGG ATCTATGCAT CTTTCAGCAG CAGCGTGTCC TCAGAGCTGC 1081 GAAGCTTGCT CTGCTGTGCC CGGGGACGCA CCCCACCCAG CCTGGGTCCC CAAGATGAGT 1141 CCTGCACCAC CGCCAGCTCC TCCCTGGCCA AGGACACTTC ATCGTGAGAC CCAGCTTTCT 1201 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1261 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1321 GTGGAAAGGA CGAAAGCCAG CTCCCAATAG CAAACTTACG CGTTAAGTCg acaatcaacc 1381 tctggattac aaaatttgtg aaagatt