Transcript: Mouse NM_001276299.1

Mus musculus arginine vasopressin receptor 2 (Avpr2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Avpr2 (12000)
Length:
1179
CDS:
143..625

Additional Resources:

NCBI RefSeq record:
NM_001276299.1
NBCI Gene record:
Avpr2 (12000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027400 GTTCTTATCTTCCGGGAGATA pLKO.1 185 CDS 100% 0.495 0.347 N Avpr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05875 pDONR223 100% 35.7% 37.4% None (many diffs) n/a
2 ccsbBroad304_05875 pLX_304 0% 35.7% 37.4% V5 (many diffs) n/a
3 TRCN0000476803 GCCACACGACGTAACACCACCTGG pLX_317 9.1% 35.7% 37.4% V5 (many diffs) n/a
4 TRCN0000489580 TGTCACCAGTAGTAGCACCTGGCT pLX_317 34.4% 35.6% 37.3% V5 (many diffs) n/a
5 TRCN0000489607 AAGCCAGCTCCCAATAGCAAACTT pLX_317 35.9% 35.7% 37.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV