Transcript: Human NR_027419.2

Homo sapiens arginine vasopressin receptor 2 (AVPR2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
AVPR2 (554)
Length:
1507
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027419.2
NBCI Gene record:
AVPR2 (554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378108 TAGTGATTGTGGTCGTCTATG pLKO_005 774 3UTR 100% 10.800 15.120 N AVPR2 n/a
2 TRCN0000356712 TGCTCATCTTCCGGGAGATTC pLKO_005 630 3UTR 100% 10.800 8.640 N AVPR2 n/a
3 TRCN0000356711 CCCTGGATCTATGCATCTTTC pLKO_005 917 3UTR 100% 10.800 7.560 N AVPR2 n/a
4 TRCN0000008110 CGCACCTATGTCACCTGGATT pLKO.1 560 3UTR 100% 4.950 3.465 N AVPR2 n/a
5 TRCN0000008112 GCCCTTTGTGCTACTCATGTT pLKO.1 868 3UTR 100% 4.950 3.465 N AVPR2 n/a
6 TRCN0000008109 GCTAGTGATTGTGGTCGTCTA pLKO.1 772 3UTR 100% 4.050 2.835 N AVPR2 n/a
7 TRCN0000011233 CAGCTCACTGAGCTGGGTGTA pLKO.1 1300 3UTR 100% 0.135 0.095 N AVPR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05875 pDONR223 100% 51.4% None (many diffs) n/a
2 ccsbBroad304_05875 pLX_304 0% 51.4% V5 (many diffs) n/a
3 TRCN0000476803 GCCACACGACGTAACACCACCTGG pLX_317 9.1% 51.4% V5 (many diffs) n/a
4 TRCN0000489580 TGTCACCAGTAGTAGCACCTGGCT pLX_317 34.4% 51.4% V5 (many diffs) n/a
5 TRCN0000489607 AAGCCAGCTCCCAATAGCAAACTT pLX_317 35.9% 51.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV