Construct: ORF TRCN0000489628
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019441.1_s317c1
- DNA Barcode:
- CTGGCGGACGACCGGGTCCTGACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AGTR1 (185)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489628
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_000685.4 | 99.6% | 99.1% | (many diffs) |
| 2 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_009585.3 | 99.6% | 99.1% | (many diffs) |
| 3 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_032049.3 | 92.1% | 91.7% | (many diffs) |
| 4 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_004835.4 | 90.7% | 90.3% | (many diffs) |
| 5 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_031850.3 | 90.7% | 90.3% | (many diffs) |
| 6 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | NM_177322.3 | 86.6% | 93.6% | (many diffs) |
| 7 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | XM_006516534.1 | 86.6% | 93.6% | (many diffs) |
| 8 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | XM_011244264.2 | 86.6% | 93.6% | (many diffs) |
| 9 | mouse | 11608 | Agtr1b | angiotensin II receptor, ty... | NM_175086.3 | 85.3% | 92.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 63
- ORF end:
- 1143
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaagcca 61 ccatgattct caactcttct actgaagatg gtattaaaag aatccaagat gattgtccca 121 aagctggaag gcataattac atatttgtca tgattcctac tttatacagt atcatctttg 181 tggtgggaat atttggaaac agcttggtgg tgatagtcat ttacttttat atgaagctga 241 agactgtggc cagtgttttt cttttgaatt tagcactggc tgacttatgc tttttactga 301 ctttgccact atgggctgtc tacacagcta tggaataccg ctggcccttt ggcaattacc 361 tatgtaagat tgcttcagcc agcgtcagtt tcaacctgta cgctagtgtg tttctactca 421 cgtgtctcag cattgatcga tacctggcta ttgttcaccc aatgaagtcc cgccttcgac 481 gcacaatgct tgtagccaaa gtcacctgca tcatcatttg gctgctggca ggcttggcca 541 gtttgccagc tataatccat cgaaatgtat ttttcattga gaacaccaat attacagttt 601 gtgctttcca ttatgagtcc caaaattcaa cccttccgat agggctgggc ctgaccaaaa 661 atatactggg tttcctgttt ccttttctga tcattcttac aagttatact cttatttgga 721 aggccgtaaa GAAGGCTTAT GAAATTCAGA AGAACAAACC AAGAAATGAT GATATTTTTA 781 AGATAATTAT GGCAATTGTG CTTTTCTTTT TCTTTTCCTG GATTCCCCAC CAAATATTCA 841 CTTTTCTGGA TGTATTGATT CAACTAGGCA TCATACGTGA CTGTAGAATT GCAGATATTG 901 TGGACACGGC CATGCCTATC ACCATTTGTA TAGCTTATTT TAACAATTGC CTGAATCCTC 961 TTTTTTATGG CTTTCTGGGG AAAAAATTTA AAAGATATTT TCTCCAGCTT CTAAAATATA 1021 TTCCCCCAAA AGCCAAATCC CACTCAAACC TTTCAACAAA AATGAGCACG CTTTCCTACC 1081 GCCACTCAGA TAATGTAAGC TCATCCACCA AGAAGCCTGC ACCATGTTTT GAGGTTGAGG 1141 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1201 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1261 TTTATATATC TTGTGGAAAG GACGACTGGC GGACGACCGG GTCCTGACGA CGCGTTAAGT 1321 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt