Construct: ORF TRCN0000489642
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020835.1_s317c1
- DNA Barcode:
- TACTAGTTAAGACCTTGTTGGCTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CCR4 (1233)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489642
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1233 | CCR4 | C-C motif chemokine receptor 4 | NM_005508.5 | 99.8% | 100% | 24C>T;1068C>T |
| 2 | human | 1233 | CCR4 | C-C motif chemokine receptor 4 | XM_017005687.1 | 99.8% | 100% | 24C>T;1068C>T |
| 3 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | NM_009916.2 | 82.8% | 86.6% | (many diffs) |
| 4 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | XM_006511933.2 | 82.8% | 86.6% | (many diffs) |
| 5 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | XM_006511934.3 | 82.8% | 86.6% | (many diffs) |
| 6 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | XM_011242933.2 | 82.8% | 86.6% | (many diffs) |
| 7 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | XM_006511932.3 | 63.9% | 66.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1152
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaacccc acggatatag cagataccac cctcgatgaa agcatataca 121 gcaattacta tctgtatgaa agtatcccca agccttgcac caaagaaggc atcaaggcat 181 ttggggagct cttcctgccc ccactgtatt ccttggtttt tgtatttggt ctgcttggaa 241 attctgtggt ggttctggtc ctgttcaaat acaagcggct caggtccatg actgatgtgt 301 acctgctcaa ccttgccatc tcggatctgc tcttcgtgtt ttccctccct ttttggggct 361 actatgcagc agaccagtgg gtttttgggc taggtctgtg caagatgatt tcctggatgt 421 acttggtggg cttttacagt ggcatattct ttgtcatgct catgagcatt gatagatacc 481 tggcaattgt gcacgcggtg ttttccttga gggcaaggac cttgacttat ggggtcatca 541 ccagtttggc tacatggtca gtggctgtgt tcgcctccct tcctggcttt ctgttcagca 601 cttgttatac tgagcgcaac catacctact gcaaaaccaa gtactctctc aactccacga 661 cgtggaaggt tctcagctcc ctggaaatca acattctcgg attggtgatc cccttaggga 721 tcatgctgtt ttgctactcc atgatcatca ggaccttgca gcattgtaaa aatgagaaga 781 agaaCAAGGC GGTGAAGATG ATCTTTGCCG TGGTGGTCCT CTTCCTTGGG TTCTGGACAC 841 CTTACAACAT AGTGCTCTTC CTAGAGACCC TGGTGGAGCT AGAAGTCCTT CAGGACTGCA 901 CCTTTGAAAG ATACTTGGAC TATGCCATCC AGGCCACAGA AACTCTGGCT TTTGTTCACT 961 GCTGCCTTAA TCCCATCATC TACTTTTTTC TGGGGGAGAA ATTTCGCAAG TACATCCTAC 1021 AGCTCTTCAA AACCTGCAGG GGCCTTTTTG TGCTCTGCCA ATACTGTGGG CTCCTCCAAA 1081 TTTACTCTGC TGACACCCCC AGCTCATCTT ACACGCAGTC CACCATGGAT CATGATCTTC 1141 ATGATGCTCT GTAGGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TACTAGTTAA GACCTTGTTG 1321 GCTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt