Transcript: Human NM_005508.5

Homo sapiens C-C motif chemokine receptor 4 (CCR4), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CCR4 (1233)
Length:
3025
CDS:
99..1181

Additional Resources:

NCBI RefSeq record:
NM_005508.5
NBCI Gene record:
CCR4 (1233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005508.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356812 ACCCTCGATGAAAGCATATAC pLKO_005 126 CDS 100% 13.200 18.480 N CCR4 n/a
2 TRCN0000356813 AGGACCTTGCAGCATTGTAAA pLKO_005 777 CDS 100% 13.200 18.480 N CCR4 n/a
3 TRCN0000356751 TGGTTCTGGTCCTGTTCAAAT pLKO_005 277 CDS 100% 13.200 9.240 N CCR4 n/a
4 TRCN0000356811 GCTCCCTGGAAATCAACATTC pLKO_005 703 CDS 100% 10.800 7.560 N CCR4 n/a
5 TRCN0000008195 CCCTTAGGGATCATGCTGTTT pLKO.1 738 CDS 100% 4.950 3.465 N CCR4 n/a
6 TRCN0000008198 GCTTTCTGTTCAGCACTTGTT pLKO.1 613 CDS 100% 4.950 3.465 N CCR4 n/a
7 TRCN0000008197 CTTTGAAAGATACTTGGACTA pLKO.1 929 CDS 100% 4.050 2.835 N CCR4 n/a
8 TRCN0000008194 GAGTCAATGAACTTTCCACAT pLKO.1 1204 3UTR 100% 4.050 2.835 N CCR4 n/a
9 TRCN0000008196 CGATGAAAGCATATACAGCAA pLKO.1 131 CDS 100% 2.640 1.848 N CCR4 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2542 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2542 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005508.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489679 GGTCAAGCCGGTCCTCCGGATTTC pLX_317 25.9% 99.8% 99.7% V5 1068C>T;1080_1081insG n/a
2 TRCN0000489642 TACTAGTTAAGACCTTGTTGGCTC pLX_317 34.3% 99.8% 100% V5 (not translated due to prior stop codon) 24C>T;1068C>T n/a
Download CSV