Transcript: Mouse NM_009916.2

Mus musculus chemokine (C-C motif) receptor 4 (Ccr4), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ccr4 (12773)
Length:
2787
CDS:
108..1190

Additional Resources:

NCBI RefSeq record:
NM_009916.2
NBCI Gene record:
Ccr4 (12773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026085 CAAGTACATCACCCAACTCTT pLKO.1 1043 CDS 100% 4.950 6.930 N Ccr4 n/a
2 TRCN0000026118 CAAGATCGTTTCATGGATGTA pLKO.1 437 CDS 100% 4.950 3.960 N Ccr4 n/a
3 TRCN0000026128 CGCCGTACAACGTGGTGCTTT pLKO.1 874 CDS 100% 1.650 1.320 N Ccr4 n/a
4 TRCN0000356751 TGGTTCTGGTCCTGTTCAAAT pLKO_005 286 CDS 100% 13.200 9.240 N CCR4 n/a
5 TRCN0000026110 CCAAGGAAGGTATCAAGGCAT pLKO.1 196 CDS 100% 2.640 1.848 N Ccr4 n/a
6 TRCN0000026109 CCAGGTCTACTCGGCTGACAT pLKO.1 1112 CDS 100% 1.650 1.155 N Ccr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489679 GGTCAAGCCGGTCCTCCGGATTTC pLX_317 25.9% 82.9% 86.4% V5 (many diffs) n/a
2 TRCN0000489642 TACTAGTTAAGACCTTGTTGGCTC pLX_317 34.3% 82.8% 86.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV