Construct: ORF TRCN0000489679
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019395.1_s317c1
- DNA Barcode:
- GGTCAAGCCGGTCCTCCGGATTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCR4 (1233)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489679
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1233 | CCR4 | C-C motif chemokine receptor 4 | NM_005508.5 | 99.8% | 99.7% | 1068C>T;1080_1081insG |
| 2 | human | 1233 | CCR4 | C-C motif chemokine receptor 4 | XM_017005687.1 | 99.8% | 99.7% | 1068C>T;1080_1081insG |
| 3 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | NM_009916.2 | 82.9% | 86.4% | (many diffs) |
| 4 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | XM_006511933.2 | 82.9% | 86.4% | (many diffs) |
| 5 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | XM_006511934.3 | 82.9% | 86.4% | (many diffs) |
| 6 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | XM_011242933.2 | 82.9% | 86.4% | (many diffs) |
| 7 | mouse | 12773 | Ccr4 | chemokine (C-C motif) recep... | XM_006511932.3 | 63.9% | 66.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1158
- ORF length:
- 1083
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgaac cccacggata tagcagacac caccctcgat gaaagcatat 121 acagcaatta ctatctgtat gaaagtatcc ccaagccttg caccaaagaa ggcatcaagg 181 catttgggga gctcttcctg cccccactgt attccttggt ttttgtattt ggtctgcttg 241 gaaattctgt ggtggttctg gtcctgttca aatacaagcg gctcaggtcc atgactgatg 301 tgtacctgct caaccttgcc atctcggatc tgctcttcgt gttttccctc cctttttggg 361 gctactatgc agcagaccag tgggtttttg ggctaggtct gtgcaagatg atttcctgga 421 tgtacttggt gggcttttac agtggcatat tctttgtcat gctcatgagc attgatagat 481 acctggcaat tgtgcacgcg gtgttttcct tgagggcaag gaccttgact tatggggtca 541 tcaccagttt ggctacatgg tcagtggctg tgttcgcctc ccttcctggc tttctgttca 601 gcacttgtta tactgagcgc aaccatacct actgcaaaac caagtactct ctcaactcca 661 cgacgtggaa ggttctcagc tccctggaaa tcaacattct cggattggtg atccccttag 721 ggatcatgct gttttgctac tccatgatca tcaggacctt gcagcattgt aaaaatgaga 781 agaagaacaa ggcggtgaag atgatctttg ccgtggtggt cctcttcctt gggttctgga 841 caccttacaa catagtgctc ttcctagaga ccctggtGGA GCTAGAAGTC CTTCAGGACT 901 GCACCTTTGA AAGATACTTG GACTATGCCA TCCAGGCCAC AGAAACTCTG GCTTTTGTTC 961 ACTGCTGCCT TAATCCCATC ATCTACTTTT TTCTGGGGGA GAAATTTCGC AAGTACATCC 1021 TACAGCTCTT CAAAACCTGC AGGGGCCTTT TTGTGCTCTG CCAATACTGT GGGCTCCTCC 1081 AAATTTACTC TGCTGACACC CCCAGCTCAT CTTACACGCA GTCCACCATG GATCATGATC 1141 TTCATGATGC TCTGGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GGTCAAGCCG GTCCTCCGGA 1321 TTTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt