Construct: ORF TRCN0000489731
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021345.1_s317c1
- DNA Barcode:
- AACCTTTGGGTAAACCGACGAGCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- UPP2 (151531)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489731
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 151531 | UPP2 | uridine phosphorylase 2 | NM_173355.3 | 99.1% | 100% | 951_952insTAGAAGCT |
| 2 | human | 151531 | UPP2 | uridine phosphorylase 2 | XM_005246359.3 | 86.1% | 85% | (many diffs) |
| 3 | human | 151531 | UPP2 | uridine phosphorylase 2 | NM_001135098.1 | 84.1% | 84.7% | 1_171del;1122_1123insTAGAAGCT |
| 4 | human | 151531 | UPP2 | uridine phosphorylase 2 | XM_017003484.1 | 79.8% | 71% | (many diffs) |
| 5 | human | 151531 | UPP2 | uridine phosphorylase 2 | XR_922881.2 | 68.9% | 1_194del;1003_1126del;1199_1200ins78 | |
| 6 | human | 151531 | UPP2 | uridine phosphorylase 2 | XR_922880.2 | 34.3% | (many diffs) | |
| 7 | human | 151531 | UPP2 | uridine phosphorylase 2 | XR_001738652.1 | 33.4% | (many diffs) | |
| 8 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | NM_029692.3 | 85.7% | 86.8% | (many diffs) |
| 9 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | XM_006498409.3 | 85.7% | 86.8% | (many diffs) |
| 10 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | XM_006498410.4 | 85.7% | 86.8% | (many diffs) |
| 11 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | XM_030252193.1 | 85.7% | 86.8% | (many diffs) |
| 12 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | NM_001289659.1 | 81.3% | 82.2% | (many diffs) |
| 13 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | XM_006498407.4 | 76.6% | 77.6% | (many diffs) |
| 14 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | XM_006498406.4 | 73.3% | 74.3% | (many diffs) |
| 15 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | XM_011239207.2 | 73.3% | 74.3% | (many diffs) |
| 16 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | XR_866022.2 | 63.2% | (many diffs) | |
| 17 | mouse | 76654 | Upp2 | uridine phosphorylase 2 | XM_011239206.3 | 52.3% | 54% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1017
- ORF length:
- 951
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaagaat 61 tcaccatggc ttcagttata cctgcctcca ataggtccat gagatctgac aggaatacat 121 atgttggaaa aaggtttgtt cacgttaaaa atccttactt ggatttgatg gatgaagaca 181 ttctctatca cttggatttg ggaacaaaaa cacacaacct accagcaatg tttggagatg 241 taaagtttgt ctgtgtcggt gggagcccca acagaatgaa agcatttgca ctgtttatgc 301 acaaggagct cgggtttgag gaagctgaag aagacataaa agacatctgt gctgggacag 361 acagatactg tatgtacaaa accgggcctg tgctcgccat cagtcacggc atgggcatcc 421 cctccatttc tattatgctt catgaactca tcaaattact ccaccatgca cggtgctgcg 481 atgtcaccat tattagaatc ggtacatcag ggggaatagg gattgcacca gggactgttg 541 taataacgga tatagctgta gactccttct ttaagccccg gtttgaacag gtcattttgg 601 acaacattgt cacccgaagt actgaactgg acaaagaact gtctgaagaa ctgttcaact 661 GTAGCAAAGA AATCCCCAAC TTCCCAACCC TCGTTGGACA TACAATGTGT ACCTATGATT 721 TTTATGAAGG CCAAGGCCGA CTAGATGGAG CACTGTGCTC CTTTTCCAGA GAAAAAAAGT 781 TAGACTACTT GAAGAGAGCA TTTAAAGCTG GTGTCAGGAA TATTGAAATG GAATCTACAG 841 TGTTTGCAGC TATGTGTGGA CTCTGTGGTC TAAAAGCTGC TGTGGTCTGT GTGACACTTC 901 TCGACAGACT CGACTGTGAT CAGATCAACT TGCCTCATGA TGTCCTGGTG GAGTACCAGC 961 AACGGCCTCA GCTCCTAATC TCCAACTTCA TCAGACGGCG GCTTGGACTT TGTGACTAGA 1021 AGCTTGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1081 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1141 CTTGGCTTTA TATATCTTGT GGAAAGGACG AAACCTTTGG GTAAACCGAC GAGCCACGCG 1201 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt