Transcript: Human XM_005246359.3

PREDICTED: Homo sapiens uridine phosphorylase 2 (UPP2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UPP2 (151531)
Length:
1216
CDS:
195..1040

Additional Resources:

NCBI RefSeq record:
XM_005246359.3
NBCI Gene record:
UPP2 (151531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246359.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183353 GACAGACAGATACTGTATGTA pLKO.1 485 CDS 100% 5.625 3.938 N UPP2 n/a
2 TRCN0000179172 GATCAGATCAACTTGCCTCAT pLKO.1 1118 3UTR 100% 4.050 2.835 N UPP2 n/a
3 TRCN0000151632 GACATTCTCTATCACTTGGAT pLKO.1 306 CDS 100% 3.000 2.100 N UPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246359.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05052 pDONR223 100% 86.9% 85% None (many diffs) n/a
2 ccsbBroad304_05052 pLX_304 0% 86.9% 85% V5 (many diffs) n/a
3 TRCN0000472567 ATTTTCGCTCTCGAAACGAACCTG pLX_317 42.4% 86.9% 85% V5 (many diffs) n/a
4 TRCN0000488047 TCCTAATAACTACGTCCAACTTTT pLX_317 29.9% 86.8% 84.7% V5 (many diffs) n/a
5 TRCN0000489731 AACCTTTGGGTAAACCGACGAGCC pLX_317 38.3% 86.1% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV