Transcript: Human XR_922880.2

PREDICTED: Homo sapiens uridine phosphorylase 2 (UPP2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UPP2 (151531)
Length:
2790
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_922880.2
NBCI Gene record:
UPP2 (151531)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_922880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183353 GACAGACAGATACTGTATGTA pLKO.1 485 3UTR 100% 5.625 3.938 N UPP2 n/a
2 TRCN0000179172 GATCAGATCAACTTGCCTCAT pLKO.1 1610 3UTR 100% 4.050 2.835 N UPP2 n/a
3 TRCN0000151632 GACATTCTCTATCACTTGGAT pLKO.1 306 3UTR 100% 3.000 2.100 N UPP2 n/a
4 TRCN0000183352 GCTGAGAAATTCATAGCAATT pLKO.1 2478 3UTR 100% 10.800 6.480 N UPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_922880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489731 AACCTTTGGGTAAACCGACGAGCC pLX_317 38.3% 34.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488047 TCCTAATAACTACGTCCAACTTTT pLX_317 29.9% 34% V5 1_194del;1005_1567del;1709_2790delinsG n/a
3 ccsbBroadEn_05052 pDONR223 100% 34% None 1_194del;1005_1567del;1709_2790del n/a
4 ccsbBroad304_05052 pLX_304 0% 34% V5 1_194del;1005_1567del;1709_2790del n/a
5 TRCN0000472567 ATTTTCGCTCTCGAAACGAACCTG pLX_317 42.4% 34% V5 1_194del;1005_1567del;1709_2790del n/a
Download CSV