Construct: ORF TRCN0000489769
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019358.1_s317c1
- DNA Barcode:
- AATTTGATTGTTCTTGGCAAGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CXCR5 (643)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489769
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 643 | CXCR5 | C-X-C motif chemokine recep... | NM_032966.2 | 99.7% | 99.6% | 879G>C;981_982insG |
| 2 | human | 643 | CXCR5 | C-X-C motif chemokine recep... | NM_001716.5 | 87.7% | 87.6% | 1_135del;1014G>C;1116_1117insG |
| 3 | mouse | 12145 | Cxcr5 | chemokine (C-X-C motif) rec... | NM_007551.2 | 73.4% | 77.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1059
- ORF length:
- 984
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggcc tccttcaagg ccgtgttcgt gcccgtggcc tacagcctca 121 tcttcctcct gggcgtgatc ggcaacgtcc tggtgctggt gatcctggag cggcaccggc 181 agacacgcag ttccacggag accttcctgt tccacctggc cgtggccgac ctcctgctgg 241 tcttcatctt gccctttgcc gtggccgagg gctctgtggg ctgggtcctg gggaccttcc 301 tctgcaaaac tgtgattgcc ctgcacaaag tcaacttcta ctgcagcagc ctgctcctgg 361 cctgcatcgc cgtggaccgc tacctggcca ttgtccacgc cgtccatgcc taccgccacc 421 gccgcctcct ctccatccac atcacctgtg ggaccatctg gctggtgggc ttcctccttg 481 ccttgccaga gattctcttc gccaaagtca gccaaggcca tcacaacaac tccctgccac 541 gttgcacctt ctcccaagag aaccaagcag aaacgcatgc ctggttcacc tcccgattcc 601 tctaccatgt ggcgggattc ctgctgccca tgctggtgat gggctggtgc tacgtggggg 661 tagtgcacag gttgcgccag gcccagcggc gcccTCAGCG GCAGAAGGCA GTCAGGGTGG 721 CCATCCTGGT GACAAGCATC TTCTTCCTCT GCTGGTCACC CTACCACATC GTCATCTTCC 781 TGGACACCCT GGCGAGGCTG AAGGCCGTGG ACAATACCTG CAAGCTGAAT GGCTCTCTCC 841 CCGTGGCCAT CACCATGTGT GAGTTCCTGG GCCTGGCCCA CTGCTGCCTC AACCCCATGC 901 TCTACACTTT CGCCGGCGTG AAGTTCCGCA GTGACCTGTC GCGGCTCCTG ACCAAGCTGG 961 GCTGTACCGG CCCTGCCTCC CTGTGCCAGC TCTTCCCTAG CTGGCGCAGG AGCAGTCTCT 1021 CTGAGTCAGA GAATGCCACC TCTCTCACCA CGTTCGACCC AGCTTTCTTG TACAAAGTGG 1081 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1141 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1201 AAATTTGATT GTTCTTGGCA AGCCCACGCG TTAAGTCgac aatcaacctc tggattacaa 1261 aatttgtgaa agatt