Transcript: Mouse NM_007551.2

Mus musculus chemokine (C-X-C motif) receptor 5 (Cxcr5), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cxcr5 (12145)
Length:
2636
CDS:
44..1168

Additional Resources:

NCBI RefSeq record:
NM_007551.2
NBCI Gene record:
Cxcr5 (12145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027343 GACGTCCTTTAAGGCGGTATT pLKO.1 187 CDS 100% 10.800 15.120 N Cxcr5 n/a
2 TRCN0000027356 CCTCATAACAACGACTCCTTA pLKO.1 626 CDS 100% 4.950 6.930 N Cxcr5 n/a
3 TRCN0000027357 GCCCTACCACATTGTCATCTT pLKO.1 868 CDS 100% 4.950 3.465 N Cxcr5 n/a
4 TRCN0000027381 GCTTGTGATGGGATGGTGTTA pLKO.1 742 CDS 100% 4.950 3.465 N Cxcr5 n/a
5 TRCN0000027315 CGGCCTCCCTTTGCCAACTTT pLKO.1 1083 CDS 100% 1.875 1.313 N Cxcr5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491673 AACGATTATTCATTAATTTAGTAA pLX_317 44.3% 73.5% 77.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489769 AATTTGATTGTTCTTGGCAAGCCC pLX_317 36.8% 73.4% 77.6% V5 (many diffs) n/a
Download CSV