Transcript: Human NM_001716.5

Homo sapiens C-X-C motif chemokine receptor 5 (CXCR5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CXCR5 (643)
Length:
4293
CDS:
51..1169

Additional Resources:

NCBI RefSeq record:
NM_001716.5
NBCI Gene record:
CXCR5 (643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001716.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356719 GTCCTAGGAGTATCCTCATTT pLKO_005 1276 3UTR 100% 13.200 10.560 N CXCR5 n/a
2 TRCN0000356720 ACAATACCTGCAAGCTGAATG pLKO_005 922 CDS 100% 10.800 7.560 N CXCR5 n/a
3 TRCN0000356785 TCACGCACCTCCCATCCTAAT pLKO_005 1453 3UTR 100% 10.800 7.560 N CXCR5 n/a
4 TRCN0000356784 TCCTTGCCTTGCCAGAGATTC pLKO_005 586 CDS 100% 10.800 7.560 N CXCR5 n/a
5 TRCN0000008140 CTGGACAGATTGGACAACTAT pLKO.1 111 CDS 100% 5.625 3.938 N CXCR5 n/a
6 TRCN0000008139 CCTGGTGACAAGCATCTTCTT pLKO.1 836 CDS 100% 4.950 3.465 N CXCR5 n/a
7 TRCN0000008141 CTGGTCTTCATCTTGCCCTTT pLKO.1 348 CDS 100% 4.050 2.835 N CXCR5 n/a
8 TRCN0000008137 CCTCCCATCCTAATCATCCAA pLKO.1 1460 3UTR 100% 3.000 2.100 N CXCR5 n/a
9 TRCN0000008138 CCAGAGATTCTCTTCGCCAAA pLKO.1 597 CDS 100% 4.050 2.430 N CXCR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001716.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491673 AACGATTATTCATTAATTTAGTAA pLX_317 44.3% 87.8% 87.9% V5 (not translated due to prior stop codon) 1_135del;1014G>C n/a
2 TRCN0000489769 AATTTGATTGTTCTTGGCAAGCCC pLX_317 36.8% 87.7% 87.6% V5 1_135del;1014G>C;1116_1117insG n/a
Download CSV