Construct: ORF TRCN0000489830
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020199.1_s317c1
- DNA Barcode:
- GACAGTGACTAATAAATACGGATT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PRKRA (8575)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489830
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8575 | PRKRA | protein activator of interf... | NM_003690.5 | 100% | 100% | |
| 2 | human | 8575 | PRKRA | protein activator of interf... | NM_001139517.1 | 94.5% | 93.9% | (many diffs) |
| 3 | human | 8575 | PRKRA | protein activator of interf... | NM_001139518.1 | 92% | 92% | 0_1ins75 |
| 4 | human | 8575 | PRKRA | protein activator of interf... | XM_011512063.2 | 70.7% | 65.9% | (many diffs) |
| 5 | human | 8575 | PRKRA | protein activator of interf... | NM_001316362.2 | 63.8% | 63.8% | 0_1ins339 |
| 6 | human | 8575 | PRKRA | protein activator of interf... | XM_011512066.2 | 63.8% | 63.8% | 0_1ins339 |
| 7 | human | 8575 | PRKRA | protein activator of interf... | XM_017005159.1 | 63.8% | 63.8% | 0_1ins339 |
| 8 | human | 8575 | PRKRA | protein activator of interf... | XR_001739008.2 | 47.9% | 1_136del;650_651ins95;981_1665del | |
| 9 | mouse | 23992 | Prkra | protein kinase, interferon ... | NM_011871.2 | 90.3% | 98% | (many diffs) |
| 10 | mouse | 23992 | Prkra | protein kinase, interferon ... | XM_011239517.2 | 63.6% | 65.9% | (many diffs) |
| 11 | mouse | 23992 | Prkra | protein kinase, interferon ... | XM_011239518.2 | 63.5% | 65.7% | (many diffs) |
| 12 | mouse | 23992 | Prkra | protein kinase, interferon ... | XM_017318023.1 | 56% | 62.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1011
- ORF length:
- 939
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtcccag agcaggcacc gcgccgaggc cccgccgctg gagcgcgagg 121 acagtgggac cttcagtttg gggaagatga taacagctaa gccagggaaa acaccgattc 181 aggtattaca cgaatacggc atgaagacca agaacatccc agtttatgaa tgtgaaagat 241 ctgatgtgca aatacacgtg cccactttca ccttcagagt aaccgttggt gacataacct 301 gcacaggtga aggtacaagt aagaagctgg cgaaacatag agctgcagag gctgccataa 361 acattttgaa agccaatgca agtatttgct ttgcagttcc tgacccctta atgcctgacc 421 cttccaagca accaaagaac cagcttaatc ctattggttc attacaggaa ttggctattc 481 atcatggctg gagacttcct gaatataccc tttcccagga gggaggacct gctcataaga 541 gagaatatac tacaatttgc aggctagagt catttatgga aactggaaag ggggcatcaa 601 aaaagcaagc caaaaggaat gctgctgaga aatTTCTTGC CAAATTTAGT AATATTTCTC 661 CAGAGAACCA CATTTCTTTA ACAAATGTAG TAGGACATTC TTTAGGATGT ACTTGGCATT 721 CCTTGAGGAA TTCTCCTGGT GAAAAGATCA ACTTACTGAA AAGAAGCCTC CTTAGTATTC 781 CAAATACAGA TTACATCCAG CTGCTTAGTG AAATTGCCAA GGAACAAGGT TTTAATATAA 841 CATATTTGGA TATAGATGAA CTGAGCGCCA ATGGACAATA TCAATGTCTT GCTGAACTGT 901 CCACCAGCCC CATCACAGTC TGTCATGGCT CCGGTATCTC CTGTGGCAAT GCACAAAGTG 961 ATGCAGCTCA CAATGCTTTG CAGTATTTAA AGATAATAGC AGAAAGAAAG TGAGACCCAG 1021 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1081 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1141 TATCTTGTGG AAAGGACGAG ACAGTGACTA ATAAATACGG ATTACGCGTT AAGTCgacaa 1201 tcaacctctg gattacaaaa tttgtgaaag att