Construct: ORF TRCN0000489834
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019879.1_s317c1
- DNA Barcode:
- TCAGCAGATTTAACTTCAGGATAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WNK1 (65125)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489834
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019839.1 | 19.1% | 18.8% | (many diffs) |
| 2 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521009.2 | 18.5% | 18.2% | (many diffs) |
| 3 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521008.2 | 18.5% | 18.2% | (many diffs) |
| 4 | human | 65125 | WNK1 | WNK lysine deficient protei... | NM_014823.3 | 18.2% | 18% | (many diffs) |
| 5 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019838.1 | 18.2% | 18% | (many diffs) |
| 6 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019837.1 | 18.2% | 18% | (many diffs) |
| 7 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019836.1 | 17.7% | 17.4% | (many diffs) |
| 8 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019835.1 | 17.7% | 17.4% | (many diffs) |
| 9 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_017019834.1 | 17.5% | 17.2% | (many diffs) |
| 10 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521007.2 | 16.5% | 16.3% | (many diffs) |
| 11 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521006.2 | 16.5% | 16.3% | (many diffs) |
| 12 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_006719003.2 | 16.3% | 16.1% | (many diffs) |
| 13 | human | 65125 | WNK1 | WNK lysine deficient protei... | NM_018979.4 | 16.3% | 16.1% | (many diffs) |
| 14 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521004.2 | 15.3% | 15.1% | (many diffs) |
| 15 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521003.2 | 15.3% | 15% | (many diffs) |
| 16 | human | 65125 | WNK1 | WNK lysine deficient protei... | NM_213655.4 | 14.8% | 14.6% | (many diffs) |
| 17 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521002.2 | 14.7% | 14.5% | (many diffs) |
| 18 | human | 65125 | WNK1 | WNK lysine deficient protei... | NM_001184985.1 | 14.7% | 14.5% | (many diffs) |
| 19 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521001.2 | 14.4% | 14.2% | (many diffs) |
| 20 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011521000.2 | 14.2% | 14% | (many diffs) |
| 21 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011520998.2 | 13.9% | 13.7% | (many diffs) |
| 22 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011520999.2 | 13.9% | 13.7% | (many diffs) |
| 23 | human | 65125 | WNK1 | WNK lysine deficient protei... | XM_011520997.3 | 13.9% | 13.7% | (many diffs) |
| 24 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_001185020.1 | 15.8% | 16.7% | (many diffs) |
| 25 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321557.1 | 15.8% | 16.7% | (many diffs) |
| 26 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321556.1 | 15.4% | 16.3% | (many diffs) |
| 27 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321555.1 | 15.4% | 16.2% | (many diffs) |
| 28 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_001185021.1 | 15.3% | 16.1% | (many diffs) |
| 29 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321554.1 | 15.3% | 16.1% | (many diffs) |
| 30 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321553.1 | 15.1% | 15.9% | (many diffs) |
| 31 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321552.1 | 14.8% | 15.6% | (many diffs) |
| 32 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321550.1 | 14.5% | 15.3% | (many diffs) |
| 33 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_198703.3 | 14.2% | 14.9% | (many diffs) |
| 34 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321549.1 | 14.2% | 14.9% | (many diffs) |
| 35 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321548.1 | 14.1% | 14.8% | (many diffs) |
| 36 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321547.1 | 14% | 14.8% | (many diffs) |
| 37 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321546.1 | 14% | 14.7% | (many diffs) |
| 38 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321545.1 | 13.9% | 14.7% | (many diffs) |
| 39 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321544.1 | 13.9% | 14.6% | (many diffs) |
| 40 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321543.1 | 13.9% | 14.6% | (many diffs) |
| 41 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_011241320.2 | 13.8% | 14.6% | (many diffs) |
| 42 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | XM_017321542.1 | 13.8% | 14.6% | (many diffs) |
| 43 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_001199083.1 | 12.8% | 13.5% | (many diffs) |
| 44 | mouse | 232341 | Wnk1 | WNK lysine deficient protei... | NM_001199084.1 | 12.8% | 13.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1254
- ORF length:
- 1182
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtctggc ggcgccgcag agaagcagag cagcactccc ggttccctgt 121 tcctctcgcc gccggctcct gcccccaaga atggctccag ctccgattcc tccgtggggg 181 agaaactggg agccgcggcc gccgacgctg tgaccggcag gaccgaggag tacaggcgcc 241 gccgccacac tatggacaag gacagccgtg gggcggccgc gaccactacc accactgagc 301 accgcttctt ccgccggagc gtcatctgcg actccaatgc cactgcactg gagcttcccg 361 gccttcctct ttccctgccc cagcccagca tccccgcggc tgtcccgcag agtgctccac 421 cggagcccca ccgggaagag accgtgaccg ccaccgccac ttcccaggta gcccagcagc 481 ctccagccgc tgccgcccct ggggaacagg ccgtcgcggg ccctgccccc tcgactgtcc 541 ccagcagtac cagcaaagac cgcccagtgt cccagcctag ccttgtgggg agcaaagagg 601 agccgccgcc ggcgagaagt ggcagcggcg gcggcagcgc caaggagcca caggaggaac 661 ggagccagca gcaggatgat atcgaagagc tggagaccaa ggccgtggga atgtctaacg 721 atggccgctt tctcaagttt gacatcgaaa tcggcagagg ctcctttaag acggtctaca 781 aaggtctgga cactgaaacc accgtggaag tcgcctGGTG TGAACTGCAG GATCGAAAAT 841 TAACAAAGTC TGAGAGGCAG AGATTTAAAG AAGAAGCTGA AATGTTAAAA GGTCTTCAGC 901 ATCCCAATAT TGTTAGATTT TATGATTCCT GGGAATCCAC AGTAAAAGGA AAGAAGTGCA 961 TTGTTTTGGT GACTGAACTT ATGACGTCTG GAACACTTAA AACGTATCTG AAAAGGTTTA 1021 AAGTGATGAA GATCAAAGTT CTAAGAAGCT GGTGCCGTCA GATCCTTAAA GGTCTTCAGT 1081 TTCTTCATAC TCGAACTCCA CCTATCATTC ACCGCGATCT TAAATGTGAC AACATCTTTA 1141 TCACCGGCCC TACTGGCTCA GTCAAGATTG GAGACCTCGG TCTGGCAACC CTGAAGCGGG 1201 CTTCTTTTGC CAAGAGTGTG ATAGGTATGT TTCAGGTGTA CCTTGGAGCC GACCCAGCTT 1261 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1321 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1381 CTTGTGGAAA GGACGATCAG CAGATTTAAC TTCAGGATAC ACGCGTTAAG TCgacaatca 1441 acctctggat tacaaaattt gtgaaagatt