Construct: ORF TRCN0000489857
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021770.1_s317c1
- DNA Barcode:
- GGCAGATTATATGGTAACACCCGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GDF11 (10220)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489857
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10220 | GDF11 | growth differentiation fact... | NM_005811.5 | 100% | 100% | |
| 2 | human | 10220 | GDF11 | growth differentiation fact... | XM_006719194.3 | 100% | 100% | |
| 3 | mouse | 14561 | Gdf11 | growth differentiation fact... | NM_010272.2 | 94% | 99% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1293
- ORF length:
- 1221
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggtgctc gcggccccgc tgctgctggg cttcctgctc ctcgccctgg 121 agctgcggcc ccggggggag gcggccgagg gccccgcggc ggcggcggcg gcggcggcgg 181 cggcggcagc ggcgggggtc gggggggagc gctccagccg gccagccccg tccgtggcgc 241 ccgagccgga cggctgcccc gtgtgcgttt ggcggcagca cagccgcgag ctgcgcctag 301 agagcatcaa gtcgcagatc ttgagcaaac tgcggctcaa ggaggcgccc aacatcagcc 361 gcgaggtggt gaagcagctg ctgcccaagg cgccgccgct gcagcagatc ctggacctac 421 acgacttcca gggcgacgcg ctgcagcccg aggacttcct ggaggaggac gagtaccacg 481 ccaccaccga gaccgtcatt agcatggccc aggagacgga cccagcagta cagacagatg 541 gcagccctct ctgctgccat tttcacttca gccccaaggt gatgttcaca aaggtactga 601 aggcccagct gtgggtgtac ctacggcctg taccccgccc agccacagtc tacctgcaga 661 tcttgcgact aaaaccccta actggggaag ggaccgcagg gggagggggc ggaggccggc 721 gtcacatccg tatccgctca ctgaagattg agctgcactc acgctcaggc cattggcaga 781 gcatcgactt caagcaagtg ctacacagct ggttccgcca gccacagagc aactggggca 841 tcgagatcaa cgcctttgat cccagtggca cagacctggc tgtcacctcc ctggggccgg 901 gagccgaggg gctgcatcca ttcatggagc ttcgagtcct agagaacaca aaacgttccc 961 ggcggaacct gggtctggac tgcgacgagc actcaagcga gtcccgctgc tgccgatatc 1021 ccctcacagt ggactttgag gctttcggct gggactggat catcgcaccT AAGCGCTACA 1081 AGGCCAACTA CTGCTCCGGC CAGTGCGAGT ACATGTTCAT GCAAAAATAT CCGCATACCC 1141 ATTTGGTGCA GCAGGCCAAT CCAAGAGGCT CTGCTGGGCC CTGTTGTACC CCCACCAAGA 1201 TGTCCCCAAT CAACATGCTC TACTTCAATG ACAAGCAGCA GATTATCTAC GGCAAGATCC 1261 CTGGCATGGT GGTGGATCGC TGTGGCTGCT CTTAAGACCC AGCTTTCTTG TACAAAGTGG 1321 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1381 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1441 AGGCAGATTA TATGGTAACA CCCGTACGCG TTAAGTCgac aatcaacctc tggattacaa 1501 aatttgtgaa agatt