Transcript: Mouse NM_010272.2

Mus musculus growth differentiation factor 11 (Gdf11), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gdf11 (14561)
Length:
5833
CDS:
34..1251

Additional Resources:

NCBI RefSeq record:
NM_010272.2
NBCI Gene record:
Gdf11 (14561)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067982 CGTATCCGTTCACTAAAGATT pLKO.1 685 CDS 100% 5.625 7.875 N Gdf11 n/a
2 TRCN0000438352 CATCGCACCTAAGCGCTACAA pLKO_005 1017 CDS 100% 4.950 6.930 N GDF11 n/a
3 TRCN0000067981 CCAGTGCGAATACATGTTCAT pLKO.1 1056 CDS 100% 4.950 6.930 N Gdf11 n/a
4 TRCN0000058950 CCCAATCAACATGCTCTACTT pLKO.1 1161 CDS 100% 4.950 6.930 N GDF11 n/a
5 TRCN0000067980 CCTGCAGATCTTACGACTGAA pLKO.1 609 CDS 100% 4.950 6.930 N Gdf11 n/a
6 TRCN0000067979 CGAGTCCTAGAGAACACGAAA pLKO.1 889 CDS 100% 4.950 6.930 N Gdf11 n/a
7 TRCN0000058948 GCAGATTATCTACGGCAAGAT pLKO.1 1194 CDS 100% 4.950 3.465 N GDF11 n/a
8 TRCN0000067978 GCAAAGGAACAGAGAGGCAAA pLKO.1 1571 3UTR 100% 4.050 2.835 N Gdf11 n/a
9 TRCN0000058952 CAGAGCATCGACTTCAAGCAA pLKO.1 733 CDS 100% 3.000 2.100 N GDF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489857 GGCAGATTATATGGTAACACCCGT pLX_317 18.9% 94% 99% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV