Transcript: Human XM_006719194.3

PREDICTED: Homo sapiens growth differentiation factor 11 (GDF11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GDF11 (10220)
Length:
1446
CDS:
40..1263

Additional Resources:

NCBI RefSeq record:
XM_006719194.3
NBCI Gene record:
GDF11 (10220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719194.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438352 CATCGCACCTAAGCGCTACAA pLKO_005 1029 CDS 100% 4.950 6.930 N GDF11 n/a
2 TRCN0000058948 GCAGATTATCTACGGCAAGAT pLKO.1 1206 CDS 100% 4.950 6.930 N GDF11 n/a
3 TRCN0000058949 CCTGCAGATCTTGCGACTAAA pLKO.1 621 CDS 100% 13.200 9.240 N GDF11 n/a
4 TRCN0000442158 GATCGCTGTGGCTGCTCTTAA pLKO_005 1243 CDS 100% 13.200 9.240 N GDF11 n/a
5 TRCN0000058950 CCCAATCAACATGCTCTACTT pLKO.1 1173 CDS 100% 4.950 3.465 N GDF11 n/a
6 TRCN0000058951 GATGTTCACAAAGGTACTGAA pLKO.1 549 CDS 100% 4.950 3.465 N GDF11 n/a
7 TRCN0000058952 CAGAGCATCGACTTCAAGCAA pLKO.1 745 CDS 100% 3.000 2.100 N GDF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719194.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489857 GGCAGATTATATGGTAACACCCGT pLX_317 18.9% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV