Construct: ORF TRCN0000489868
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019489.1_s317c1
- DNA Barcode:
- CTATGATACTTTATCATCGTTCTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AKT2 (208)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489868
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001626.6 | 97.2% | 97.1% | (many diffs) |
| 2 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526614.1 | 97.2% | 97.1% | (many diffs) |
| 3 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526615.1 | 97.2% | 97.1% | (many diffs) |
| 4 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526616.1 | 97.2% | 97.1% | (many diffs) |
| 5 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526618.1 | 97.2% | 97.1% | (many diffs) |
| 6 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526619.1 | 97.2% | 97.1% | (many diffs) |
| 7 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526620.1 | 97.2% | 97.1% | (many diffs) |
| 8 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_017026470.2 | 97.2% | 97.1% | (many diffs) |
| 9 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_024451416.1 | 97.2% | 97.1% | (many diffs) |
| 10 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001330511.1 | 88.5% | 88.4% | (many diffs) |
| 11 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_024451417.1 | 88.5% | 88.4% | (many diffs) |
| 12 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001243027.3 | 84.7% | 84.8% | 0_1ins225;1257G>A |
| 13 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001243028.3 | 84.7% | 84.8% | 0_1ins225;1257G>A |
| 14 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526622.2 | 80.3% | 79.3% | (many diffs) |
| 15 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001110208.2 | 87.9% | 95.3% | (many diffs) |
| 16 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001331108.1 | 87.9% | 95.3% | (many diffs) |
| 17 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001331109.1 | 87.9% | 95.3% | (many diffs) |
| 18 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_007434.4 | 87.9% | 95.3% | (many diffs) |
| 19 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539477.1 | 87.9% | 95.3% | (many diffs) |
| 20 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539480.1 | 87.9% | 95.3% | (many diffs) |
| 21 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539481.3 | 87.9% | 95.3% | (many diffs) |
| 22 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539482.1 | 80.2% | 86.6% | (many diffs) |
| 23 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539483.1 | 80.2% | 86.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 78
- ORF end:
- 1560
- ORF length:
- 1482
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaatccg 61 cggccgcccc cttcaccatg ggtagcaaca agagcaagcc caaggatgcc agccagcgga 121 atgaggtgtc tgtcatcaaa gaaggctggc tccacaagcg tggtgaatac atcaagacct 181 ggaggccacg gtatttcctg ctgaagagcg acggctcctt cattgggtac aaggagaggc 241 ccgaggcccc tgatcagact ctacccccct taaacaactt ctccgtagca gaatgccagc 301 tgatgaagac cgagaggccg cgacccaaca cctttgtcat acgctgcctg cagtggacca 361 cagtcatcga gaggaccttc cacgtggatt ctccagacga gagggaggag tggatgcggg 421 ccatccagat ggtcgccaac agcctcaagc agcgggcccc aggcgaggac cccatggact 481 acaagtgtgg ctcccccagt gactcctcca cgactgagga gatggaagtg gcggtcagca 541 aggcacgggc taaagtgacc atgaatgact tcgactatct caaactcctt ggcaagggaa 601 cctttggcaa agtcatcctg gtgcgggaga aggccactgg ccgctactac gccatgaaga 661 tcctgcggaa ggaagtcatc attgccaagg atgaagtcgc tcacacagtc accgagagcc 721 gggtcctcca gaacaccagg cacccgttcc tcactgcgct gaagtatgcc ttccagaccc 781 acgaccgcct gtgctttgtg atggagtatg ccaacggggg tgagctgttc ttccacctgt 841 cccgggagcg tgtcttcaca gaggagcggg cccggtttta tggtgcagag attgtctcgg 901 ctcttgagta cttgcactcg cgggacgtgg tataccgcga catcaagctg gaaaacctca 961 tgctggacaa agatggccac atcaagatca ctgactttgg cctctgcaaa gagggcatca 1021 gtgacggggc caccatgaaa accttctgtg ggaccccgga gtacctggcg cctgaggtgc 1081 tggaggacaa tgactatggc cgggccgtgg actggtgggg gctgggtgtg gtcatgtacg 1141 agatgatgtg cggccgcctg cccttctaca accaggacca cgagcgcctc ttcgagctca 1201 tcctcatgga agagatccgc ttcccgcgca cgctcagccc cgaggccaag tccctgcttg 1261 ctgggctgct taagaaggac cccaagcaga ggcttggtgg ggggcccagc gatgccaagg 1321 aggtcatgga gcacaggttc ttcctcagca tcaactggca ggacgtggtc cagaagaagc 1381 tcctgccaCC CTTCAAACCT CAGGTCACGT CCGAGGTCGA CACAAGGTAC TTCGATGATG 1441 AATTTACCGC CCAGTCCATC ACAATCACAC CCCCTGACCG CTATGACAGC CTGGGCTTAC 1501 TGGAGCTGGA CCAGCGGACC CACTTCCCCC AGTTCTCCTA CTCGGCCAGC ATCCGCGAAA 1561 AGGGTGGGCG CGCCGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1621 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1681 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CTATGATACT TTATCATCGT 1741 TCTTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt