Construct: ORF TRCN0000491293
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019841.2_s317c1
- DNA Barcode:
- CAAGCCACGGCCGGCCACCGCAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VIPR1 (7433)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491293
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_004624.4 | 99.7% | 99.5% | 444T>C;1022G>T;1371_1372insG |
| 2 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265437.2 | 99.5% | 99.3% | (many diffs) |
| 3 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251885.1 | 93.8% | 93% | (many diffs) |
| 4 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251882.1 | 90.8% | 90.6% | (many diffs) |
| 5 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265438.3 | 90.8% | 90.6% | (many diffs) |
| 6 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_011534079.1 | 90.8% | 90.6% | (many diffs) |
| 7 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265439.2 | 89.5% | 86.4% | (many diffs) |
| 8 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251884.1 | 89.2% | 86.2% | (many diffs) |
| 9 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_011534080.2 | 75.6% | 71.7% | (many diffs) |
| 10 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251883.1 | 53.3% | 39.5% | (many diffs) |
| 11 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_001740254.1 | 48.6% | (many diffs) | |
| 12 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_940500.2 | 48.2% | (many diffs) | |
| 13 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_001740255.1 | 39.6% | (many diffs) | |
| 14 | mouse | 22354 | Vipr1 | vasoactive intestinal pepti... | XM_006512068.3 | 85.7% | 84.3% | (many diffs) |
| 15 | mouse | 22354 | Vipr1 | vasoactive intestinal pepti... | NM_011703.4 | 85.6% | 84.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1443
- ORF length:
- 1374
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gcgcccgcca agtccgctgc ccgcccgctg gctatgcgtg ctggcaggcg 121 ccctcgcctg ggcccttggg ccggcgggcg gccaggcggc caggctgcag gaggagtgtg 181 actatgtgca gatgatcgag gtgcagcaca agcagtgcct ggaggaggcc cagctggaga 241 atgagacaat aggctgcagc aagatgtggg acaacctcac ctgctggcca gccacccctc 301 ggggccaggt agttgtcttg gcctgtcccc tcatcttcaa gctcttctcc tccattcaag 361 gccgcaatgt aagccgcagc tgcaccgacg aaggctggac gcacctggag cctggcccgt 421 accccattgc ctgtggtttg gatgacaagg cagcgagttt ggatgagcag cagaccatgt 481 tctacggttc tgtgaagacc ggctacacca tcggctacgg cctgtccctc gccacccttc 541 tggtcgccac agctatcctg agcctgttca ggaagctcca ctgcacgcgg aactacatcc 601 acatgcacct cttcatatcc ttcatcctga gggctgccgc tgtcttcatc aaagacttgg 661 ccctcttcga cagcggggag tcggaccagt gctccgaggg ctcggtgggc tgtaaggcag 721 ccatggtctt tttccaatat tgtgtcatgg ctaacttctt ctggctgctg gtggagggcc 781 tctacctgta caccctgctt gccgtctcct tcttctctga gcggaagtac ttctgggggt 841 acatactcat cggctggggg gtacccagca cattcaccat ggtgtggacc atcgccagga 901 tccattttga ggattatggg tgctgggaca ccatcaactc ctcactgtgg tggatcataa 961 agggccccat cctcacctcc atcttggtaa acttcatcct gtttatttgc atcatccgaa 1021 tcctgcttca gaaactgcgg cccccagata tcaggaagag tgacagcagt ccatactcaa 1081 ggctagccat gtccacactc ctgctgatcc ccctgtttgg agtacactac atcatgttcg 1141 ccttctttcc ggacaatttt aagccTGAAG TGAAGATGGT CTTTGAGCTC GTCGTGGGGT 1201 CTTTCCAGGG TTTTGTGGTG GCTATCCTCT ACTGCTTCCT CAATGGTGAG GTGCAGGCGG 1261 AGCTGAGGCG GAAGTGGCGG CGCTGGCACC TGCAGGGCGT CCTGGGCTGG AACCCCAAAT 1321 ACCGGCACCC GTCGGGAGGC AGCAACGGCG CCACGTGCAG CACGCAGGTT TCCATGCTGA 1381 CCCGCGTCAG CCCAGGTGCC CGCCGCTCCT CCAGCTTCCA AGCCGAAGTC TCCCTGGTCG 1441 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1501 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1561 TTTATATATC TTGTGGAAAG GACGACAAGC CACGGCCGGC CACCGCAAAA CGCGTTAAGT 1621 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt