Construct: ORF TRCN0000491309
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019793.2_s317c1
- DNA Barcode:
- TGCTTGGCTGCTGCTTGCCCCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FDPS (2224)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491309
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2224 | FDPS | farnesyl diphosphate synthase | NM_001135821.2 | 99.9% | 99.7% | 1257_1258insG |
| 2 | human | 2224 | FDPS | farnesyl diphosphate synthase | NM_002004.4 | 99.9% | 99.7% | 1257_1258insG |
| 3 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_024454066.1 | 92.2% | 92% | 922_1026del;1362_1363insG |
| 4 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_024454070.1 | 92.2% | 92% | 922_1026del;1362_1363insG |
| 5 | human | 2224 | FDPS | farnesyl diphosphate synthase | NM_001135822.2 | 84.1% | 84% | 0_1ins198;1059_1060insG |
| 6 | human | 2224 | FDPS | farnesyl diphosphate synthase | NM_001242824.2 | 84.1% | 84% | 0_1ins198;1059_1060insG |
| 7 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_005244962.1 | 84.1% | 84% | 0_1ins198;1059_1060insG |
| 8 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_005244963.1 | 84.1% | 84% | 0_1ins198;1059_1060insG |
| 9 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_024454071.1 | 77.6% | 77.5% | 0_1ins198;724_828del;1164_1165insG |
| 10 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_024454072.1 | 77.6% | 77.5% | 0_1ins198;724_828del;1164_1165insG |
| 11 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_024454073.1 | 77.6% | 77.5% | 0_1ins198;724_828del;1164_1165insG |
| 12 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_024454074.1 | 77.6% | 77.5% | 0_1ins198;724_828del;1164_1165insG |
| 13 | human | 2224 | FDPS | farnesyl diphosphate synthase | NM_001242825.1 | 59.1% | 59% | 0_1ins513;744_745insG |
| 14 | human | 2224 | FDPS | farnesyl diphosphate synthase | XM_024454076.1 | 54.5% | 54.5% | 0_1ins513;409_513del;849_850insG |
| 15 | human | 619190 | FDPSP2 | farnesyl diphosphate syntha... | NR_003262.1 | 22.1% | (many diffs) | |
| 16 | mouse | 110196 | Fdps | farnesyl diphosphate synthe... | NM_001253751.1 | 85.5% | 83.3% | (many diffs) |
| 17 | mouse | 110196 | Fdps | farnesyl diphosphate synthe... | NM_134469.4 | 71.8% | 70.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1329
- ORF length:
- 1260
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gcccctgtcc cgctggttga gatctgtggg ggtcttcctg ctgccagccc 121 cctactgggc accccgggag aggtggctgg gttccctacg gcggccctcc ctggtgcacg 181 ggtacccagt cctggcctgg cacagtgccc gctgctggtg ccaagcgtgg acagaggaac 241 ctcgagccct ttgctcctcc ctcagaatga acggagacca gaattcagat gtttatgccc 301 aagaaaagca ggatttcgtt cagcacttct cccagatcgt tagggtgctg actgaggatg 361 agatggggca cccagagata ggagatgcta ttgcccggct caaggaggtc ctggagtaca 421 atgccattgg aggcaagtat aaccggggtt tgacggtggt agtagcattc cgggagctgg 481 tggagccaag gaaacaggat gctgatagtc tccagcgggc ctggactgtg ggctggtgtg 541 tggaactgct gcaagctttc ttcctggtgg cagatgacat catggattca tcccttaccc 601 gccggggaca gatctgctgg tatcagaagc cgggcgtggg tttggatgcc atcaatgatg 661 ctaacctcct ggaagcatgt atctaccgcc tgctgaagct ctattgccgg gagcagccct 721 attacctgaa cctgatcgag ctcttcctgc agagttccta tcagactgag attgggcaga 781 ccctggacct cctcacagcc ccccagggca atgtggatct tgtcagattc actgaaaaga 841 ggtacaaatc tattgtcaag tacaagacag ctttctactc cttctacctt cctatagctg 901 cagccatgta catggcagga attgatggcg agaaggagca cgccaatgcc aagaagatcc 961 tgctggagat gggggagttc tttcagattc aggatgatta ccttgacctc tttggGGACC 1021 CCAGTGTGAC CGGCAAAATT GGCACTGACA TCCAGGACAA CAAATGCAGC TGGCTGGTGG 1081 TTCAGTGTCT GCAACGGGCC ACTCCAGAAC AGTACCAGAT CCTGAAGGAA AATTACGGGC 1141 AGAAGGAGGC TGAGAAAGTG GCCCGGGTGA AGGCGCTATA TGAGGAGCTG GATCTGCCAG 1201 CAGTGTTCTT GCAATATGAG GAAGACAGTT ACAGCCACAT TATGGCTCTC ATTGAACAGT 1261 ACGCAGCACC CCTGCCCCCA GCCGTCTTTC TGGGGCTTGC GCGCAAAATC TACAAGCGGA 1321 GAAAGGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1381 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1441 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATGCTTGGCT GCTGCTTGCC CCTTCACGCG 1501 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt