Transcript: Mouse NM_001253751.1

Mus musculus farnesyl diphosphate synthetase (Fdps), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fdps (110196)
Length:
1478
CDS:
144..1406

Additional Resources:

NCBI RefSeq record:
NM_001253751.1
NBCI Gene record:
Fdps (110196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076174 CGCCAGATCTTAGAGGAGAAT pLKO.1 1191 CDS 100% 4.950 3.465 N Fdps n/a
2 TRCN0000325549 CGCCAGATCTTAGAGGAGAAT pLKO_005 1191 CDS 100% 4.950 3.465 N Fdps n/a
3 TRCN0000076176 GCCATGTGGATCTTGGTAGAT pLKO.1 886 CDS 100% 4.950 3.465 N Fdps n/a
4 TRCN0000076177 GCTTTCTTCCTTGTGTCAGAT pLKO.1 633 CDS 100% 4.950 3.465 N Fdps n/a
5 TRCN0000325636 GCTTTCTTCCTTGTGTCAGAT pLKO_005 633 CDS 100% 4.950 3.465 N Fdps n/a
6 TRCN0000076173 GCAGAATTTCATCCAGCACTT pLKO.1 386 CDS 100% 4.050 2.835 N Fdps n/a
7 TRCN0000325620 GCAGAATTTCATCCAGCACTT pLKO_005 386 CDS 100% 4.050 2.835 N Fdps n/a
8 TRCN0000076175 GCTTTCTTCAAGTATGAGGAA pLKO.1 1281 CDS 100% 2.640 1.584 N Fdps n/a
9 TRCN0000325621 GCTTTCTTCAAGTATGAGGAA pLKO_005 1281 CDS 100% 2.640 1.584 N Fdps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00548 pDONR223 100% 85.5% 83.5% None (many diffs) n/a
2 ccsbBroad304_00548 pLX_304 0% 85.5% 83.5% V5 (many diffs) n/a
3 TRCN0000478886 ATGCCACGCACATGTGTTTGCCTC pLX_317 29.1% 85.5% 83.5% V5 (many diffs) n/a
4 TRCN0000488829 CACAGTTCCGAAGCCCGCAGAAGA pLX_317 27.9% 85.5% 83.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491309 TGCTTGGCTGCTGCTTGCCCCTTC pLX_317 25% 85.5% 83.3% V5 (many diffs) n/a
Download CSV