Construct: ORF TRCN0000491331
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008678.1_s317c1
- Derived from:
- ccsbBroadEn_07465
- DNA Barcode:
- CCACTCGTTCTAAAACAGCGAAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRC14 (9684)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491331
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9684 | LRRC14 | leucine rich repeat contain... | NM_001272036.2 | 99.9% | 100% | 73T>C |
| 2 | human | 9684 | LRRC14 | leucine rich repeat contain... | NM_014665.4 | 99.9% | 100% | 73T>C |
| 3 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_005272358.5 | 99.9% | 100% | 73T>C |
| 4 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_005272359.5 | 99.9% | 100% | 73T>C |
| 5 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_024447336.1 | 99.9% | 100% | 73T>C |
| 6 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_005272360.5 | 92% | 92% | 0_1ins117 |
| 7 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_017014005.2 | 92% | 92% | 0_1ins117 |
| 8 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_024447337.1 | 92% | 92% | 0_1ins117 |
| 9 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_024447338.1 | 76% | 76% | 0_1ins354 |
| 10 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_024447339.1 | 76% | 76% | 0_1ins354 |
| 11 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_024447340.1 | 76% | 76% | 0_1ins354 |
| 12 | human | 9684 | LRRC14 | leucine rich repeat contain... | XM_024447341.1 | 76% | 76% | 0_1ins354 |
| 13 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | NM_145471.2 | 85.4% | 94.1% | (many diffs) |
| 14 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | XM_006520785.3 | 85.4% | 94.1% | (many diffs) |
| 15 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | XM_006520786.3 | 85.4% | 94.1% | (many diffs) |
| 16 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | XM_006520787.2 | 85.4% | 94.1% | (many diffs) |
| 17 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | XM_006520789.3 | 85.4% | 94.1% | (many diffs) |
| 18 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | XM_011245579.2 | 85.4% | 94.1% | (many diffs) |
| 19 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | XM_017316558.1 | 85.4% | 94.1% | (many diffs) |
| 20 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | XM_017316559.1 | 85.4% | 94.1% | (many diffs) |
| 21 | mouse | 223664 | Lrrc14 | leucine rich repeat contain... | XM_017316560.1 | 52.2% | 56.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1545
- ORF length:
- 1479
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca cacgcttgtg ttcttgagca cacggcaggt gctgcagtgc cagccagctg 121 cctgccaggc cctgcccctg ctgccacgcg aactcttccc cctgctgttc aaggtggcct 181 tcatggacaa gaagacagtg gtactgcgcg agttggtaca cacgtggccc ttcccgctgc 241 tcagtttcca gcagctgcta caggagtgtg cccactgcag ccgtgccctc ctgcaggagc 301 ggcctagcac tgagagcatg caggctgtta tcctggggct gactgcccgg ctccacacct 361 cagagcctgg ggccagcaca cagcccctct gcaggaagca tgcgctgcgg gtgctggaca 421 tgacgggcct cttggatgat ggtgtggaac aggatcctgg caccatgagc atgtgggact 481 gtactgctgc cgtagctcgc acatgcattg cccagcagca gggtggggcc gcagagcctg 541 ggccagcccc catccccgtg gaggtgcgcg tggacctgcg ggtgaaccgg gcctcctatg 601 cgttcctgcg ggaggcactc cgaagcagcg tgggcagccc gctgcggctc tgctgccggg 661 acctgcgagc tgaggacctg cccatgcgca acactgtggc cctgctgcag cttctggatg 721 caggctgcct gcgccgcgtg gacctgcgct tcaacaatct gggcctgcgc ggcctgtctg 781 tgatcatccc acacgtggcc cgcttccagc acctggccag cctgcggctc cactatgtgc 841 atggggattc aaggcagccc tccgtggatg gcgaggacaa cttccgctac ttccttgccc 901 agatgggccg cttcacctgt ctgcgtgagc tcagcatggg ctcctctctc ctttcaggga 961 ggctggacca gctgctcagc accctgcaga gccccctgga gagcctggag ttggccttct 1021 gtgctctgct gcctgaggac ctacgcttcc tggcacggag cccacatgct gcccacctca 1081 agaagttgga cctgagtggt aacgacctgt ctggcagcca gctggcaccc ttccagggtc 1141 tgttgcaggc atcagcagcc acactgttgc atctggagct gactgagtgt cagctcgcag 1201 acacccagct gttggccaca ctacccatcc tgactcagtg cgccagtcTC CGGTACCTTG 1261 GCCTCTATGG CAACCCACTG TCCATGGCGG GCCTCAAGGA GCTGCTGCGG GACTCAGTGG 1321 CACAGGCTGA GCTGCGTACT GTGGTGCACC CCTTCCCTGT GGACTGCTAT GAGGGCTTGC 1381 CCTGGCCGCC GCCTGCCTCT GTCCTGCTGG AGGCCTCCAT CAATGAGGAG AAGTTTGCCC 1441 GCGTAGAAGC TGAGTTGCAC CAGCTGCTTC TAGCCTCAGG CCGTGCCCAT GTGCTCTGGA 1501 CCACGGACAT CTACGGGCGA CTGGCTGCGG ACTACTTCAG CCTATGCCCA ACTTTCTTGT 1561 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1621 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1681 GAAAGGACGA CCACTCGTTC TAAAACAGCG AAGAACGCGT TAAGTCgaca atcaacctct 1741 ggattacaaa atttgtgaaa gatt