Transcript: Human XM_024447337.1

PREDICTED: Homo sapiens leucine rich repeat containing 14 (LRRC14), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC14 (9684)
Length:
2296
CDS:
386..1750

Additional Resources:

NCBI RefSeq record:
XM_024447337.1
NBCI Gene record:
LRRC14 (9684)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418731 TGAGAGCATGCAGGCTGTTAT pLKO_005 514 CDS 100% 13.200 9.240 N LRRC14 n/a
2 TRCN0000441326 TCCATTGCCCTGCTCAGTTTG pLKO_005 1992 3UTR 100% 10.800 7.560 N LRRC14 n/a
3 TRCN0000164353 CTCCATCAATGAGGAGAAGTT pLKO.1 1618 CDS 100% 4.950 3.465 N LRRC14 n/a
4 TRCN0000164923 GATGATGGTGTGGAACAGGAT pLKO.1 638 CDS 100% 2.640 1.848 N LRRC14 n/a
5 TRCN0000165866 GAAGTTGGACCTGAGTGGTAA pLKO.1 1285 CDS 100% 4.950 2.970 N LRRC14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07465 pDONR223 100% 92% 92% None 0_1ins117 n/a
2 ccsbBroad304_07465 pLX_304 0% 92% 92% V5 0_1ins117 n/a
3 TRCN0000491331 CCACTCGTTCTAAAACAGCGAAGA pLX_317 20.4% 92% 92% V5 0_1ins117 n/a
Download CSV