Transcript: Mouse XM_006520789.3

PREDICTED: Mus musculus leucine rich repeat containing 14 (Lrrc14), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc14 (223664)
Length:
2232
CDS:
301..1782

Additional Resources:

NCBI RefSeq record:
XM_006520789.3
NBCI Gene record:
Lrrc14 (223664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339758 CCGGCTAGCTGCAGACTATTT pLKO_005 1752 CDS 100% 13.200 18.480 N Lrrc14 n/a
2 TRCN0000201528 CGTAGTGAAGCCTGACACAAA pLKO.1 1793 3UTR 100% 4.950 6.930 N Lrrc14 n/a
3 TRCN0000339832 CGTAGTGAAGCCTGACACAAA pLKO_005 1793 3UTR 100% 4.950 6.930 N Lrrc14 n/a
4 TRCN0000339834 CCGAGTAGACCTTCGGGTAAA pLKO_005 801 CDS 100% 10.800 8.640 N Lrrc14 n/a
5 TRCN0000192736 GAGTTACACCAACTGCTGTTA pLKO.1 1687 CDS 100% 4.950 3.960 N Lrrc14 n/a
6 TRCN0000339757 TGCGTGGCCTGTCTGTCATTA pLKO_005 1001 CDS 100% 13.200 9.240 N Lrrc14 n/a
7 TRCN0000351039 AGGACAACTTTCGCTACTTTC pLKO_005 1109 CDS 100% 10.800 7.560 N Lrrc14 n/a
8 TRCN0000164353 CTCCATCAATGAGGAGAAGTT pLKO.1 1650 CDS 100% 4.950 3.465 N LRRC14 n/a
9 TRCN0000201556 CCTGTCTGTCATTATCCCACA pLKO.1 1008 CDS 100% 2.160 1.512 N Lrrc14 n/a
10 TRCN0000200920 CTTTGTCTATGGCAGGACTTA pLKO.1 1511 CDS 100% 4.950 2.970 N Lrrc14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07465 pDONR223 100% 85.4% 94.1% None (many diffs) n/a
2 ccsbBroad304_07465 pLX_304 0% 85.4% 94.1% V5 (many diffs) n/a
3 TRCN0000491331 CCACTCGTTCTAAAACAGCGAAGA pLX_317 20.4% 85.4% 94.1% V5 (many diffs) n/a
Download CSV