Construct: ORF TRCN0000491377
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010672.1_s317c1
- Derived from:
- ccsbBroadEn_00899
- DNA Barcode:
- AAGACTCACACCTGAGATTGATTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNK2 (3776)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491377
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3776 | KCNK2 | potassium two pore domain c... | NM_014217.4 | 100% | 100% | |
| 2 | human | 3776 | KCNK2 | potassium two pore domain c... | XM_017001249.1 | 99.6% | 99.5% | 1_4delATGTinsA |
| 3 | human | 3776 | KCNK2 | potassium two pore domain c... | NM_001017424.3 | 97.3% | 97.1% | 1_34delinsA |
| 4 | human | 3776 | KCNK2 | potassium two pore domain c... | XM_017001248.1 | 97.3% | 97.1% | 1_34delinsA |
| 5 | human | 3776 | KCNK2 | potassium two pore domain c... | NM_001017425.3 | 96.4% | 96.2% | 1_46delinsA |
| 6 | human | 3776 | KCNK2 | potassium two pore domain c... | XM_011509522.2 | 90% | 90% | 0_1ins123 |
| 7 | human | 3776 | KCNK2 | potassium two pore domain c... | XM_011509523.1 | 90% | 90% | 0_1ins123 |
| 8 | human | 3776 | KCNK2 | potassium two pore domain c... | XM_011509524.2 | 90% | 90% | 0_1ins123 |
| 9 | mouse | 16526 | Kcnk2 | potassium channel, subfamil... | NM_010607.3 | 89% | 96.5% | (many diffs) |
| 10 | mouse | 16526 | Kcnk2 | potassium channel, subfamil... | NM_001281847.1 | 88.3% | 95.6% | (many diffs) |
| 11 | mouse | 16526 | Kcnk2 | potassium channel, subfamil... | XM_006497121.3 | 86.6% | 93.8% | (many diffs) |
| 12 | mouse | 16526 | Kcnk2 | potassium channel, subfamil... | NM_001159850.1 | 85.8% | 92.9% | (many diffs) |
| 13 | mouse | 16526 | Kcnk2 | potassium channel, subfamil... | NM_001281848.1 | 71% | 63.4% | (many diffs) |
| 14 | mouse | 16526 | Kcnk2 | potassium channel, subfamil... | XM_006497122.3 | 71% | 63.4% | (many diffs) |
| 15 | mouse | 16526 | Kcnk2 | potassium channel, subfamil... | XM_017318154.1 | 71% | 63.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1299
- ORF length:
- 1233
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcacctgac ttgctggatc ctaaatctgc cgctcagaac tccaaaccga 121 ggctctcgtt ttccacgaaa cccacagtgc ttgcttcccg ggtggagagt gacacgacca 181 ttaatgttat gaaatggaag acggtctcca cgatattcct ggtggttgtc ctctatctga 241 tcatcggagc caccgtgttc aaagcattgg agcagcctca tgagatttca cagaggacca 301 ccattgtgat ccagaagcaa acattcatat cccaacattc ctgtgtcaat tcgacggagc 361 tggatgaact cattcagcaa atagtggcag caataaatgc agggattata ccgttaggaa 421 acacctccaa tcaaatcagt cactgggatt tgggaagttc cttcttcttt gctggcactg 481 ttattacaac cataggattt ggaaacatct caccacgcac agaaggcggc aaaatattct 541 gtatcatcta tgccttactg ggaattcccc tctttggttt tctcttggct ggagttggag 601 atcagctagg caccatattt ggaaaaggaa ttgccaaagt ggaagatacg tttattaagt 661 ggaatgttag tcagaccaag attcgcatca tctcaacaat catatttata ctatttggct 721 gtgtactctt tgtggctctg cctgcgatca tattcaaaca catagaaggc tggagtgccc 781 tggacgccat ttattttgtg gttatcactc taacaactat tggatttggt gactacgttg 841 caggtggatc cgatattgaa tatctggact tctataagcc tgtcgtgtgg ttctggatcc 901 ttgtagggct tgcttacttt gctgctgtcc tgagcatgat tGGAGATTGG CTCCGAGTGA 961 TATCTAAAAA GACAAAAGAA GAGGTGGGAG AGTTCAGAGC ACACGCTGCT GAGTGGACAG 1021 CCAACGTCAC AGCCGAATTC AAAGAAACCA GGAGGCGACT GAGTGTGGAG ATTTATGACA 1081 AGTTCCAGCG GGCCACCTCC ATCAAGCGGA AGCTCTCGGC AGAACTGGCT GGAAACCACA 1141 ATCAGGAGCT GACTCCTTGT AGGAGGACCC TGTCAGTGAA CCACCTGACC AGCGAGAGGG 1201 ATGTCTTGCC TCCCTTACTG AAGACTGAGA GTATCTATCT GAATGGTTTG ACGCCACACT 1261 GTGCTGGTGA AGAGATTGCT GTGATTGAGA ACATCAAATA CCCAACTTTC TTGTACAAAG 1321 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1381 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1441 ACGAAAGACT CACACCTGAG ATTGATTTAC GCGTTAAGTC gacaatcaac ctctggatta 1501 caaaatttgt gaaagatt