Transcript: Human XM_011509522.2

PREDICTED: Homo sapiens potassium two pore domain channel subfamily K member 2 (KCNK2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNK2 (3776)
Length:
4800
CDS:
1740..2852

Additional Resources:

NCBI RefSeq record:
XM_011509522.2
NBCI Gene record:
KCNK2 (3776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415626 GATCAGCTAGGCACCATATTT pLKO_005 2151 CDS 100% 15.000 21.000 N KCNK2 n/a
2 TRCN0000431081 GCATCATCTCAACAATCATAT pLKO_005 2236 CDS 100% 13.200 10.560 N KCNK2 n/a
3 TRCN0000432932 GCCTAGATATGGACCATTTAT pLKO_005 3230 3UTR 100% 15.000 10.500 N KCNK2 n/a
4 TRCN0000425763 GAGATTGGCTCCGAGTGATAT pLKO_005 2494 CDS 100% 13.200 9.240 N KCNK2 n/a
5 TRCN0000043725 CCAAAGTGGAAGATACGTTTA pLKO.1 2185 CDS 100% 10.800 7.560 N KCNK2 n/a
6 TRCN0000043726 CTGAAGACTGAGAGTATCTAT pLKO.1 2769 CDS 100% 5.625 3.938 N KCNK2 n/a
7 TRCN0000043727 CCGTTAGGAAACACCTCCAAT pLKO.1 1962 CDS 100% 4.950 3.465 N KCNK2 n/a
8 TRCN0000043724 GCGATCATATTCAAACACATA pLKO.1 2295 CDS 100% 4.950 3.465 N KCNK2 n/a
9 TRCN0000043723 GCAGCAATAAATGCAGGGATT pLKO.1 1938 CDS 100% 4.050 2.430 N KCNK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00899 pDONR223 100% 90% 90% None 0_1ins123 n/a
2 TRCN0000491377 AAGACTCACACCTGAGATTGATTT pLX_317 29.3% 90% 90% V5 0_1ins123 n/a
Download CSV