Transcript: Mouse NM_001281847.1

Mus musculus potassium channel, subfamily K, member 2 (Kcnk2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Kcnk2 (16526)
Length:
3314
CDS:
193..1437

Additional Resources:

NCBI RefSeq record:
NM_001281847.1
NBCI Gene record:
Kcnk2 (16526)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001281847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222360 CGGCCATTAATGTTATGAAAT pLKO.1 311 CDS 100% 13.200 18.480 N Kcnk2 n/a
2 TRCN0000222359 GCGGTCATATTCAAGCACATA pLKO.1 880 CDS 100% 4.950 6.930 N Kcnk2 n/a
3 TRCN0000222361 GCTAGGAACTATATTTGGAAA pLKO.1 741 CDS 100% 4.950 3.465 N Kcnk2 n/a
4 TRCN0000222362 GCAGCAATAAACGCAGGGATT pLKO.1 523 CDS 100% 4.050 2.430 N Kcnk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00899 pDONR223 100% 88.3% 95.6% None (many diffs) n/a
2 TRCN0000491377 AAGACTCACACCTGAGATTGATTT pLX_317 29.3% 88.3% 95.6% V5 (many diffs) n/a
Download CSV