Construct: ORF TRCN0000491395
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016992.1_s317c1
- Derived from:
- ccsbBroadEn_00996
- DNA Barcode:
- GATGTTCCGCCACACGCTGCTAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BORCS8-MEF2B (4207)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491395
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 100271849 | MEF2B | myocyte enhancer factor 2B | NM_001367282.1 | 100% | 100% | |
2 | human | 4207 | BORCS8-MEF2B | BORCS8-MEF2B readthrough | NM_005919.4 | 100% | 100% | |
3 | human | 100271849 | MEF2B | myocyte enhancer factor 2B | NM_001145785.2 | 82.1% | 68.8% | 765_876del;1104_1105ins103 |
4 | human | 4207 | BORCS8-MEF2B | BORCS8-MEF2B readthrough | NR_027308.2 | 64.7% | 1_466del;1562_1691del | |
5 | human | 4207 | BORCS8-MEF2B | BORCS8-MEF2B readthrough | NR_027307.2 | 60.7% | 1_466del;1231_1342del;1674_1803del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1164
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggggaggaaa aaaatccaga tctcccgcat cctggaccaa aggaatcggc 121 aggtgacgtt caccaagcgg aagttcgggc tgatgaagaa ggcctatgag ctgagcgtgc 181 tctgtgactg tgagatagcc ctcatcatct tcaacagcgc caaccgcctc ttccagtatg 241 ccagcacgga catggaccgt gtgctgctga agtacacaga gtacagcgag ccccacgaga 301 gccgcaccaa cactgacatc ctcgagacgc tgaagcggag gggcattggc ctcgatgggc 361 cagagctgga gccggatgaa gggcctgagg agccaggaga gaagtttcgg aggctggcag 421 gcgaaggggg tgatccggcc ttgccccgac cccggctgta tcctgcagct cctgctatgc 481 ccagcccaga tgtggtatac ggggccttac cgccaccagg ctgtgacccc agtgggcttg 541 gggaagcact gcccgcccag agccgcccat ctcccttccg accagcagcc cccaaagccg 601 ggcccccagg cctggtgcac cctctcttct caccaagcca cctcaccagc aagacaccac 661 ccccactgta cctgccgacg gaagggcgga ggtcagacct gcctggtggc ctggctgggc 721 cccgaggggg actaaacacc tccagaagcc tctacagtgg cctgcagaac ccctgctcca 781 ctgcaactcc cggaccccca ctggggagct tccccttcct ccccggaggc cccccagtgg 841 gggccgaagc ctgggcgagg agggtccccc aacccgcggc gcctccccgc cgaccccccc 901 agtcagcatc aagtctgagc gcctctcTCC GGCCCCCGGG GGCCCCGGCG ACTTTCCTAA 961 GACCTTCCCC TATCCCTTGC TCCTCGCCCG GTCCCTGGCA GAGCCTCTGC GGCCTGGGCC 1021 CGCCCTGCGC CGGCTGCCCT TGGCCGACGG CTGGCCCCGG TAGGAGATCA CCCGGTGGCA 1081 CCAGCCCAGA GCGCTCGCCA GGTACGGCGA GGGCACGTGG GGACCCCACC TCCCTCCAGG 1141 CCTCTTCAGA GAAGACCCAA CAGTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1201 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1261 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG ATGTTCCGCC 1321 ACACGCTGCT AAGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1381 att