Construct: ORF TRCN0000491437
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005773.1_s317c1
- Derived from:
- ccsbBroadEn_02883
- DNA Barcode:
- CTACTGCGGTACATGAGTCCGCGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C1orf43 (25912)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491437
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 25912 | C1orf43 | chromosome 1 open reading f... | NM_001098616.3 | 100% | 100% | |
2 | human | 25912 | C1orf43 | chromosome 1 open reading f... | NM_001297720.2 | 92.8% | 92.4% | 286_287ins54 |
3 | human | 25912 | C1orf43 | chromosome 1 open reading f... | NM_015449.4 | 86.5% | 86.5% | 65_66ins102 |
4 | human | 25912 | C1orf43 | chromosome 1 open reading f... | NM_001297718.2 | 86.1% | 86.1% | 0_1ins105 |
5 | human | 25912 | C1orf43 | chromosome 1 open reading f... | NM_138740.4 | 79.4% | 79% | 65_66ins102;184_185ins54 |
6 | human | 25912 | C1orf43 | chromosome 1 open reading f... | NM_001297723.1 | 74.7% | 74.7% | 567_568ins192 |
7 | human | 25912 | C1orf43 | chromosome 1 open reading f... | NM_001297721.1 | 61.2% | 61.2% | 65_66ins102;465_466ins192 |
8 | human | 25912 | C1orf43 | chromosome 1 open reading f... | NM_001297717.2 | 59.8% | 59.2% | 286_287ins54;451delG;456_457ins250 |
9 | mouse | 99650 | 4933434E20Rik | RIKEN cDNA 4933434E20 gene | NM_001287087.1 | 89.7% | 95.6% | (many diffs) |
10 | mouse | 99650 | 4933434E20Rik | RIKEN cDNA 4933434E20 gene | NM_025762.3 | 89.7% | 95.6% | (many diffs) |
11 | mouse | 99650 | 4933434E20Rik | RIKEN cDNA 4933434E20 gene | NM_027500.4 | 67.4% | 71.5% | (many diffs) |
12 | mouse | 99650 | 4933434E20Rik | RIKEN cDNA 4933434E20 gene | NM_001287086.1 | 44% | 47.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 825
- ORF length:
- 759
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtccggcagt aactggctct ccggggtgaa tgtcgtgctg gtgatggcct 121 acgggagcct ggtgtttgta ctgctattta tttttgtgaa gaggcaaatc atgcgctttg 181 caatgaaatc tcgaagggga cctcatgtcc ctgtgggaca caatgccccc aaggacttga 241 aagaggagat tgatattcga ctctccaggg ttcaggatat caagtatgag ccccagctcc 301 ttgcagatga tgatgctaga ctactacaac tggaaaccca gggaaatcaa agttgctaca 361 actatctgta taggatgaaa gctctggatg ccattcgtac ctctgagatc ccatttcatt 421 ctgaaggccg gcatccccgt tccttaatgg gcaagaattt ccgctcctac ctgctggatc 481 tgcgaaacac tagtacgcct ttcaagggtg tacgcaaagc actcattgat acccttttgg 541 atggctatga aacagcccgc tatgggacag gggtctttgg ccagaatgag taccTACGCT 601 ATCAGGAGGC CCTGAGTGAG CTGGCCACTG CGGTTAAAGC ACGAATTGGG AGCTCTCAGC 661 GACATCACCA GTCAGCAGCC AAAGACCTAA CTCAGTCCCC TGAGGTCTCC CCAACAACCA 721 TCCAGGTGAC ATACCTCCCC TCCAGTCAGA AGAGTAAACG TGCCAAGCAC TTCCTTGAAT 781 TGAAGAGCTT TAAGGATAAC TATAACACAT TGGAGAGTAC TCTGTGCCTA AATTTCTTGT 841 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 901 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 961 GAAAGGACGA CTACTGCGGT ACATGAGTCC GCGAACGCGT TAAGTCgaca atcaacctct 1021 ggattacaaa atttgtgaaa gatt