Transcript: Mouse NM_025762.3

Mus musculus RIKEN cDNA 4933434E20 gene (4933434E20Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
4933434E20Rik (99650)
Length:
2522
CDS:
253..1014

Additional Resources:

NCBI RefSeq record:
NM_025762.3
NBCI Gene record:
4933434E20Rik (99650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328469 TCCGTTTAAACCAGGTGTATT pLKO_005 1403 3UTR 100% 13.200 18.480 N 4933434E20Rik n/a
2 TRCN0000126070 GCGAAATACTAGCACTCCTTT pLKO.1 669 CDS 100% 4.950 6.930 N 4933434E20Rik n/a
3 TRCN0000353516 CTAACTCAGTCACCTGAAATG pLKO_005 874 CDS 100% 10.800 8.640 N 4933434E20Rik n/a
4 TRCN0000353451 ACTTGCTAGATCTGCGAAATA pLKO_005 656 CDS 100% 13.200 9.240 N 4933434E20Rik n/a
5 TRCN0000126073 CCTAACTCAGTCACCTGAAAT pLKO.1 873 CDS 100% 13.200 9.240 N 4933434E20Rik n/a
6 TRCN0000126071 CCTGGAACTGAAGAGCTTTAA pLKO.1 960 CDS 100% 13.200 9.240 N 4933434E20Rik n/a
7 TRCN0000328407 AGAGTGAGTACTTACGATATC pLKO_005 770 CDS 100% 10.800 7.560 N 4933434E20Rik n/a
8 TRCN0000328468 GGGTTCAAGATATCAAGTATG pLKO_005 455 CDS 100% 10.800 7.560 N 4933434E20Rik n/a
9 TRCN0000126069 CCCTGTTAAATGCTGTTTAAT pLKO.1 1260 3UTR 100% 1.500 1.050 N 4933434E20Rik n/a
10 TRCN0000126072 GCAGATGATGATACCAGACTA pLKO.1 490 CDS 100% 4.950 2.970 N 4933434E20Rik n/a
11 TRCN0000158882 GTTGCTACAACTATCTGTATA pLKO.1 539 CDS 100% 13.200 7.920 N C1orf43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02883 pDONR223 100% 89.7% 95.6% None (many diffs) n/a
2 ccsbBroad304_02883 pLX_304 0% 89.7% 95.6% V5 (many diffs) n/a
3 TRCN0000491437 CTACTGCGGTACATGAGTCCGCGA pLX_317 30.9% 89.7% 95.6% V5 (many diffs) n/a
4 ccsbBroadEn_11783 pDONR223 100% 67.3% 71.5% None (many diffs) n/a
5 ccsbBroad304_11783 pLX_304 0% 67.3% 71.5% V5 (many diffs) n/a
6 TRCN0000479124 TAGTTCACTTGTAACGGAGTACGC pLX_317 75.1% 67.3% 71.5% V5 (many diffs) n/a
Download CSV