Transcript: Human NM_001297718.2

Homo sapiens chromosome 1 open reading frame 43 (C1orf43), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
C1orf43 (25912)
Length:
1601
CDS:
212..868

Additional Resources:

NCBI RefSeq record:
NM_001297718.2
NBCI Gene record:
C1orf43 (25912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159036 GCTTGTGTCTAAAGGGTAATT pLKO.1 1014 3UTR 100% 13.200 18.480 N C1orf43 n/a
2 TRCN0000161890 GCTAGACTACTACAACTGGAA pLKO.1 356 CDS 100% 2.640 3.696 N C1orf43 n/a
3 TRCN0000165938 GCGAAACACTAGTACGCCTTT pLKO.1 523 CDS 100% 0.000 0.000 N C1orf43 n/a
4 TRCN0000164685 CCAGAATGAGTACCTACGCTA pLKO.1 622 CDS 100% 2.640 2.112 N C1orf43 n/a
5 TRCN0000165105 CCTTCCCTGTTCCAGGTTTAT pLKO.1 1185 3UTR 100% 13.200 9.240 N C1orf43 n/a
6 TRCN0000158882 GTTGCTACAACTATCTGTATA pLKO.1 393 CDS 100% 13.200 9.240 N C1orf43 n/a
7 TRCN0000166126 CGTACCTCTGAGATCCCATTT pLKO.1 437 CDS 100% 10.800 7.560 N C1orf43 n/a
8 TRCN0000162356 CCTCTGAGATCCCATTTCATT pLKO.1 441 CDS 100% 5.625 3.938 N C1orf43 n/a
9 TRCN0000159037 GAAGAGCTTTAAGGATAACTA pLKO.1 823 CDS 100% 5.625 3.938 N C1orf43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02883 pDONR223 100% 86.1% 86.1% None 0_1ins105 n/a
2 ccsbBroad304_02883 pLX_304 0% 86.1% 86.1% V5 0_1ins105 n/a
3 TRCN0000491437 CTACTGCGGTACATGAGTCCGCGA pLX_317 30.9% 86.1% 86.1% V5 0_1ins105 n/a
4 ccsbBroadEn_11783 pDONR223 100% 60.7% 60.8% None 0_1ins105;441C>T;463_654del n/a
5 ccsbBroad304_11783 pLX_304 0% 60.7% 60.8% V5 0_1ins105;441C>T;463_654del n/a
6 TRCN0000479124 TAGTTCACTTGTAACGGAGTACGC pLX_317 75.1% 60.7% 60.8% V5 0_1ins105;441C>T;463_654del n/a
Download CSV