Construct: ORF TRCN0000491472
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019347.2_s317c1
- DNA Barcode:
- TATGATTGGCAGTCGTGTAATGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OPRL1 (4987)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491472
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_000913.6 | 99.8% | 99.4% | 44G>A;1110_1111insG |
| 2 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001200019.2 | 99.8% | 99.4% | 44G>A;1110_1111insG |
| 3 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_182647.4 | 99.8% | 99.4% | 44G>A;1110_1111insG |
| 4 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027854.1 | 99.8% | 99.4% | 44G>A;1110_1111insG |
| 5 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318854.1 | 98.4% | 98.1% | 44G>A;218_219insGTACGTCATCCTCAG;1095_1096insG |
| 6 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027855.1 | 98.4% | 98.1% | 44G>A;218_219insGTACGTCATCCTCAG;1095_1096insG |
| 7 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_011528828.3 | 95.1% | 94.8% | 1_54del;98G>A;1164_1165insG |
| 8 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_017027853.1 | 95.1% | 94.8% | 1_54del;98G>A;1164_1165insG |
| 9 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318853.2 | 92.6% | 99.4% | 44G>A;1111_1197delinsG |
| 10 | human | 4987 | OPRL1 | opioid related nociceptin r... | NM_001318855.1 | 87.3% | 80.4% | 0_1ins115;118_145del;1023_1024insG |
| 11 | human | 4987 | OPRL1 | opioid related nociceptin r... | XM_011528830.3 | 78% | 77.8% | 0_1ins243;867_868insG |
| 12 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001252565.1 | 85.2% | 93.2% | (many diffs) |
| 13 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_011012.5 | 85.2% | 93.2% | (many diffs) |
| 14 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316323.1 | 85.2% | 93.2% | (many diffs) |
| 15 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316325.1 | 85.2% | 93.2% | (many diffs) |
| 16 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318920.1 | 83.9% | 91.9% | (many diffs) |
| 17 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_006500582.2 | 83.9% | 91.9% | (many diffs) |
| 18 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318919.1 | 79.1% | 93.2% | (many diffs) |
| 19 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318923.1 | 78.5% | 77.1% | (many diffs) |
| 20 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318922.1 | 77.8% | 76.1% | (many diffs) |
| 21 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318924.1 | 67.8% | 75.2% | (many diffs) |
| 22 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | NM_001318925.1 | 67.8% | 75.2% | (many diffs) |
| 23 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_006500584.2 | 67.8% | 75.2% | (many diffs) |
| 24 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316326.1 | 67.8% | 75.2% | (many diffs) |
| 25 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316328.1 | 67.8% | 75.2% | (many diffs) |
| 26 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316329.1 | 67.8% | 75.2% | (many diffs) |
| 27 | mouse | 18389 | Oprl1 | opioid receptor-like 1 | XM_017316330.1 | 67.8% | 75.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1188
- ORF length:
- 1113
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggag cccctcttcc ccgcgccgtt ctgggaggtt atctacgaca 121 gccaccttca gggcaacctg tccctcctga gccccaacca cagtctgctg cccccgcatc 181 tgctgctcaa tgccagccac ggcgccttcc tgcccctcgg gctcaaggtc accatcgtgg 241 ggctctacct ggccgtgtgt gtcggagggc tcctggggaa ctgccttgtc atgtacgtca 301 tcctcaggca caccaaaatg aagacagcca ccaatattta catctttaac ctggccctgg 361 ccgacactct ggtcctgctg acgctgccct tccagggcac ggacatcctc ctgggcttct 421 ggccgtttgg gaatgcgctg tgcaagacag tcattgccat tgactactac aacatgttca 481 ccagcacctt caccctaact gccatgagtg tggatcgcta tgtagccatc tgccacccca 541 tccgtgccct cgacgtccgc acgtccagca aagcccaggc tgtcaatgtg gccatctggg 601 ccctggcctc tgttgtcggt gttcccgttg ccatcatggg ctcggcacag gtcgaggatg 661 aagagatcga gtgcctggtg gagatcccta cccctcagga ttactggggc ccggtgtttg 721 ccatctgcat cttcctcttc tccttcatcg tccccgtgct cgtcatctct gtctgctaca 781 gcctcatgat ccggcggctc cgtggagtcc gcctgctctc gggctcccga gagaaggacc 841 ggaacctgcg gcgcatcact cggctggtgc tggtggtagt ggctgtgttc gtgggctgct 901 ggacgcctgt ccaggtcttc gtgctggccc aagggctggg ggttcagccg agcagcgaga 961 ctgccgtggc cattctgcgc ttctgcacgg ccctgggcta cgtcaacagc tgcctcaacc 1021 ccatcctcTA CGCCTTCCTG GATGAGAACT TCAAGGCCTG CTTCCGCAAG TTCTGCTGTG 1081 CATCTGCCCT GCGCCGGGAC GTGCAGGTGT CTGACCGCGT GCGCAGCATT GCCAAGGACG 1141 TGGCCCTGGC CTGCAAGACC TCTGAGACGG TACCGCGGCC CGCAGACCCA GCTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA TATGATTGGC AGTCGTGTAA TGCCACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt