Transcript: Mouse NM_001318922.1

Mus musculus opioid receptor-like 1 (Oprl1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Oprl1 (18389)
Length:
3033
CDS:
324..1385

Additional Resources:

NCBI RefSeq record:
NM_001318922.1
NBCI Gene record:
Oprl1 (18389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001318922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027850 CCTCGTCATGTATGTCATCCT pLKO.1 448 CDS 100% 2.640 3.696 N Oprl1 n/a
2 TRCN0000445625 AGTAAAGCCCAGGCCGTTAAT pLKO_005 765 CDS 100% 13.200 10.560 N Oprl1 n/a
3 TRCN0000446123 GGAACCTGTCTCTCCTAAATG pLKO_005 306 5UTR 100% 13.200 9.240 N Oprl1 n/a
4 TRCN0000444725 GCACAGAACTGGTGATCATAC pLKO_005 1844 3UTR 100% 10.800 7.560 N Oprl1 n/a
5 TRCN0000027807 CTATGCTTTCTTGGATGAGAA pLKO.1 1226 CDS 100% 4.950 3.465 N Oprl1 n/a
6 TRCN0000027784 CTGGTAGTTGTGGCTGTGTTT pLKO.1 1068 CDS 100% 4.950 3.465 N Oprl1 n/a
7 TRCN0000027766 GCACTGTGCAAGACGGTCATT pLKO.1 633 CDS 100% 4.950 3.465 N Oprl1 n/a
8 TRCN0000027792 CCCTGTATTTGCCATCTGCAT pLKO.1 908 CDS 100% 2.640 1.848 N Oprl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01121 pDONR223 100% 77.9% 76.3% None (many diffs) n/a
2 ccsbBroad304_01121 pLX_304 0% 77.9% 76.3% V5 (many diffs) n/a
3 TRCN0000492360 GTCATAAACCAAACCCATAGAACC pLX_317 35.6% 77.9% 76.3% V5 (many diffs) n/a
4 TRCN0000489391 CGGCTAAAATAAGGTTTGTATGAA pLX_317 30.8% 77.9% 76.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491472 TATGATTGGCAGTCGTGTAATGCC pLX_317 14.6% 77.8% 76.1% V5 (many diffs) n/a
Download CSV