Transcript: Human XM_011528828.3

PREDICTED: Homo sapiens opioid related nociceptin receptor 1 (OPRL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OPRL1 (4987)
Length:
3291
CDS:
281..1447

Additional Resources:

NCBI RefSeq record:
XM_011528828.3
NBCI Gene record:
OPRL1 (4987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009271 GCGCTGTGCAAGACAGTCATT pLKO.1 695 CDS 100% 4.950 6.930 N OPRL1 n/a
2 TRCN0000357702 GTCATTGCCATTGACTACTAC pLKO_005 710 CDS 100% 4.950 6.930 N OPRL1 n/a
3 TRCN0000009272 CTGCCTTGTCATGTACGTCAT pLKO.1 541 CDS 100% 4.050 5.670 N OPRL1 n/a
4 TRCN0000357699 ACATCATGGGACAGGTCAAAG pLKO_005 1626 3UTR 100% 10.800 7.560 N OPRL1 n/a
5 TRCN0000357701 CCATGAGTGTGGATCGCTATG pLKO_005 762 CDS 100% 6.000 4.200 N OPRL1 n/a
6 TRCN0000009273 CATTGCCATTGACTACTACAA pLKO.1 712 CDS 100% 4.950 3.465 N OPRL1 n/a
7 TRCN0000009269 GCAAATGCACTTCCTACAGAT pLKO.1 2856 3UTR 100% 4.950 3.465 N OPRL1 n/a
8 TRCN0000357700 CCACCAATATTTACATCTTTA pLKO_005 588 CDS 100% 13.200 7.920 N OPRL1 n/a
9 TRCN0000009270 GCCACCAATATTTACATCTTT pLKO.1 587 CDS 100% 5.625 3.375 N OPRL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01121 pDONR223 100% 95.3% 95.3% None 1_54del n/a
2 ccsbBroad304_01121 pLX_304 0% 95.3% 95.3% V5 1_54del n/a
3 TRCN0000492360 GTCATAAACCAAACCCATAGAACC pLX_317 35.6% 95.3% 95.3% V5 1_54del n/a
4 TRCN0000489391 CGGCTAAAATAAGGTTTGTATGAA pLX_317 30.8% 95.2% 95.1% V5 (not translated due to prior stop codon) 1_54del;98G>A n/a
5 TRCN0000491472 TATGATTGGCAGTCGTGTAATGCC pLX_317 14.6% 95.1% 94.8% V5 1_54del;98G>A;1164_1165insG n/a
Download CSV