Construct: ORF TRCN0000491494
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021864.2_s317c1
- DNA Barcode:
- CCGTCTGTTACTCGGGCCCATTAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- KYAT1 (883)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491494
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001122671.1 | 100% | 100% | |
2 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352988.1 | 100% | 100% | |
3 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352989.1 | 100% | 100% | |
4 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352990.1 | 100% | 100% | |
5 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352991.1 | 100% | 100% | |
6 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352992.1 | 100% | 100% | |
7 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352993.1 | 100% | 100% | |
8 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_004059.5 | 100% | 100% | |
9 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_011519168.1 | 100% | 100% | |
10 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_011519169.1 | 100% | 100% | |
11 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_011519170.2 | 100% | 100% | |
12 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_017015265.1 | 100% | 100% | |
13 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_017015267.1 | 100% | 100% | |
14 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352997.1 | 92.5% | 92.5% | 1_102del |
15 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352998.1 | 92.5% | 92.5% | 1_102del |
16 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_011519167.3 | 89.9% | 89.9% | 1_141del |
17 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001122672.1 | 88.1% | 88.1% | 201_202ins150 |
18 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352999.1 | 86.2% | 86.2% | 0_1ins174 |
19 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_024447709.1 | 86.2% | 86.2% | 0_1ins174 |
20 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352995.1 | 81.9% | 81.9% | 1_279del |
21 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352996.1 | 81.9% | 81.9% | 1_279del |
22 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001287390.2 | 81.7% | 81.7% | 1_282del |
23 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352994.1 | 81.7% | 81.7% | 1_282del |
24 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_017015262.1 | 81.7% | 81.7% | 1_282del |
25 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_017015260.1 | 79.7% | 79.7% | 1_321del |
26 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NR_109829.2 | 64.6% | 1_185del;873_904del;1484_1957del | |
27 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NR_148224.1 | 48.4% | 1_185del;1306_1993del;2140_2613del | |
28 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NR_148225.1 | 42.1% | (many diffs) | |
29 | mouse | 70266 | Kyat1 | kynurenine aminotransferase 1 | XR_001783176.1 | 32.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1335
- ORF length:
- 1266
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggccaaacag ctgcaggccc gaaggctaga cgggatcgac tacaacccct 121 gggtggagtt tgtgaaactg gccagtgagc atgacgtcgt gaacttgggc cagggcttcc 181 cggatttccc accaccagac tttgccgtgg aagcctttca gcacgctgtc agtggagact 241 tcatgcttaa ccagtacacc aagacatttg gttacccacc actgacgaag atcctggcaa 301 gtttctttgg ggagctgctg ggtcaggaga tagacccgct caggaatgtg ctggtgactg 361 ttggtggcta tggggccctg ttcacagcct tccaggccct ggtggacgaa ggagacgagg 421 tcatcatcat cgaacccttt tttgactgct acgagcccat gacaatgatg gcagggggtc 481 gtcctgtgtt tgtgtccctg aagccgggtc ccatccagaa tggagaactg ggttccagca 541 gcaactggca gctggacccc atggagctgg ccggcaaatt cacatcacgc accaaagccc 601 tggtcctcaa cacccccaac aaccccctgg gcaaggtgtt ctccagggaa gagctggagc 661 tggtggccag cctttgccag cagcatgacg tggtgtgtat cactgatgaa gtctaccagt 721 ggatggtcta cgacgggcac cagcacatca gcattgccag cctccctggc atgtgggaac 781 ggaccctgac catcggcagc gccggcaaga ccttcagcgc cactggctgg aaggtgggct 841 gggtcctggg tccagatcac atcatgaagc acctgcggac cgtgcaccag aactccgtct 901 tccactgccc cacgcagagc caggctgcag tagccgagag ctttgaacgg gagcagctgc 961 tcttccgcca acccagcagc TACTTTGTGC AGTTCCCGCA GGCCATGCAG CGCTGCCGTG 1021 ACCACATGAT ACGTAGCCTA CAGTCAGTGG GCCTGAAGCC CATCATCCCT CAGGGCAGCT 1081 ACTTCCTCAT CACAGACATC TCAGACTTCA AGAGGAAGAT GCCTGACTTG CCTGGAGCTG 1141 TGGATGAGCC CTATGACAGA CGCTTCGTCA AGTGGATGAT CAAGAACAAG GGCTTGGTGG 1201 CCATCCCTGT CTCCATCTTC TATAGTGTGC CACATCAGAA GCACTTTGAC CACTATATCC 1261 GCTTCTGTTT TGTGAAGGAT GAAGCCACGC TCCAGGCCAT GGACGAGAAG CTGCGGAAGT 1321 GGAAGGTGGA ACTCTAGGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1381 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1441 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACCGTCTG TTACTCGGGC 1501 CCATTAGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt