Construct: ORF TRCN0000491531
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001762.1_s317c1
- Derived from:
- ccsbBroadEn_07605
- DNA Barcode:
- CGAAACCGTATGGCCATTAATGCT
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LYPLA1 (10434)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491531
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10434 | LYPLA1 | lysophospholipase 1 | NM_006330.4 | 100% | 100% | |
| 2 | human | 10434 | LYPLA1 | lysophospholipase 1 | NM_001279358.2 | 93.9% | 93.9% | 459_460ins42 |
| 3 | human | 10434 | LYPLA1 | lysophospholipase 1 | NM_001279357.2 | 93% | 93% | 167_168ins48 |
| 4 | human | 10434 | LYPLA1 | lysophospholipase 1 | XM_017012956.2 | 90.4% | 90.4% | 101_102ins66 |
| 5 | human | 10434 | LYPLA1 | lysophospholipase 1 | NM_001279356.1 | 85.2% | 85.2% | 357_358ins102 |
| 6 | human | 10434 | LYPLA1 | lysophospholipase 1 | NM_001279359.2 | 78.6% | 76% | 0_1ins107;20_21ins40 |
| 7 | human | 10434 | LYPLA1 | lysophospholipase 1 | XM_005251127.5 | 78.6% | 76% | 0_1ins107;20_21ins40 |
| 8 | human | 10434 | LYPLA1 | lysophospholipase 1 | XM_017012957.2 | 78.6% | 76% | 0_1ins107;20_21ins40 |
| 9 | human | 10434 | LYPLA1 | lysophospholipase 1 | XM_017012958.1 | 72.6% | 70% | 0_1ins107;20_21ins40;312_313ins42 |
| 10 | human | 10434 | LYPLA1 | lysophospholipase 1 | NM_001279360.1 | 72.1% | 72.1% | 0_1ins192 |
| 11 | human | 10434 | LYPLA1 | lysophospholipase 1 | XM_017012959.1 | 72.1% | 72.1% | 0_1ins192 |
| 12 | human | 10434 | LYPLA1 | lysophospholipase 1 | XM_017012960.1 | 72.1% | 72.1% | 0_1ins192 |
| 13 | human | 10434 | LYPLA1 | lysophospholipase 1 | XR_001745453.1 | 24% | 1_174del;460_461ins74;791_2491del | |
| 14 | human | 10434 | LYPLA1 | lysophospholipase 1 | XR_001745454.1 | 21.9% | (many diffs) | |
| 15 | mouse | 18777 | Lypla1 | lysophospholipase 1 | NM_008866.2 | 88.5% | 91.7% | (many diffs) |
| 16 | mouse | 18777 | Lypla1 | lysophospholipase 1 | XM_006495472.3 | 66.6% | 68.6% | (many diffs) |
| 17 | mouse | 18777 | Lypla1 | lysophospholipase 1 | XM_006495471.3 | 60% | 61.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 756
- ORF length:
- 690
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg cggcaataac atgtcaaccc cgctgcccgc catcgtgccc gccgcccgga 121 aggccaccgc tgcggtgatt ttcctgcatg gattgggaga tactgggcac ggatgggcag 181 aagcctttgc aggtatcaga agttcacata tcaaatatat ctgcccgcat gcgcctgtta 241 ggcctgttac attaaatatg aacgtggcta tgccttcatg gtttgatatt attgggcttt 301 caccagattc acaggaggat gaatctggga ttaaacaggc agcagaaaat ataaaagctt 361 tgattgatca agaagtgaag aatggcattc cttctaacag aattattttg ggagggtttt 421 ctcaggGAGG AGCTTTATCT TTATATACTG CCCTTACCAC ACAGCAGAAA CTGGCAGGTG 481 TCACTGCACT CAGTTGCTGG CTTCCACTTC GGGCTTCCTT TCCACAGGGT CCTATCGGTG 541 GTGCTAATAG AGATATTTCT ATTCTCCAGT GCCACGGGGA TTGTGACCCT TTGGTTCCCC 601 TGATGTTTGG TTCTCTTACG GTGGAAAAAC TAAAAACATT GGTGAATCCA GCCAATGTGA 661 CCTTTAAAAC CTATGAAGGT ATGATGCACA GTTCGTGTCA ACAGGAAATG ATGGATGTCA 721 AGCAATTCAT TGATAAACTC CTACCTCCAA TTGATGCCGC CCAACTTTCT TGTACAAAGT 781 GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG 841 AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA 901 CGACGAAACC GTATGGCCAT TAATGCTACG CGTTAAGTCg acaatcaacc tctggattac 961 aaaatttgtg aaagatt