Transcript: Human NM_001279357.2

Homo sapiens lysophospholipase 1 (LYPLA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
LYPLA1 (10434)
Length:
2467
CDS:
125..769

Additional Resources:

NCBI RefSeq record:
NM_001279357.2
NBCI Gene record:
LYPLA1 (10434)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001279357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052063 CGGTGGTGCTAATAGAGATAT pLKO.1 547 CDS 100% 13.200 9.240 N LYPLA1 n/a
2 TRCN0000299950 CGGTGGTGCTAATAGAGATAT pLKO_005 547 CDS 100% 13.200 9.240 N LYPLA1 n/a
3 TRCN0000052065 GCAGGTATCAGAAGTTCACAT pLKO.1 248 CDS 100% 4.950 3.465 N LYPLA1 n/a
4 TRCN0000052066 CAAGAAGTGAAGAATGGCATT pLKO.1 380 CDS 100% 4.050 2.835 N LYPLA1 n/a
5 TRCN0000299952 CAAGAAGTGAAGAATGGCATT pLKO_005 380 CDS 100% 4.050 2.835 N LYPLA1 n/a
6 TRCN0000052064 CCCTGATGTTTGGTTCTCTTA pLKO.1 609 CDS 100% 4.950 2.970 N LYPLA1 n/a
7 TRCN0000299894 CCCTGATGTTTGGTTCTCTTA pLKO_005 609 CDS 100% 4.950 2.970 N LYPLA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001279357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07605 pDONR223 100% 93% 93% None 167_168ins48 n/a
2 ccsbBroad304_07605 pLX_304 0% 93% 93% V5 (not translated due to frame shift) 167_168ins48 n/a
3 TRCN0000491531 CGAAACCGTATGGCCATTAATGCT pLX_317 48% 93% 93% V5 (not translated due to frame shift) 167_168ins48 n/a
Download CSV