Construct: ORF TRCN0000491535
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019714.2_s317c1
- DNA Barcode:
- CCGAAACTCTCCGAGAGGCGTCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NTRK3 (4916)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491535
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_002530.4 | 99.9% | 99.8% | 678C>T;2475_2476insG |
| 2 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720543.4 | 99.9% | 99.8% | 678C>T;2475_2476insG |
| 3 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022240.1 | 99.9% | 99.8% | 678C>T;2475_2476insG |
| 4 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001243101.1 | 98.9% | 98.7% | 1204_1205ins24;2451_2452insG |
| 5 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720544.4 | 98.9% | 98.7% | 678C>T;1204_1205ins24;2451_2452insG |
| 6 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001012338.2 | 98.2% | 98.2% | 2133_2174del;2517_2518insG |
| 7 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022253.2 | 98.2% | 98.2% | 678C>T;2133_2174del;2517_2518insG |
| 8 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022254.2 | 96.9% | 96.9% | 678C>T;2134_2208del;2550_2551insG |
| 9 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022241.1 | 91.7% | 89.4% | (many diffs) |
| 10 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022242.2 | 88.4% | 84.4% | (many diffs) |
| 11 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022243.1 | 88% | 88% | 0_1ins294;384C>T;2181_2182insG |
| 12 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022244.2 | 88% | 88% | 0_1ins294;384C>T;2181_2182insG |
| 13 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022245.2 | 88% | 88% | 0_1ins294;384C>T;2181_2182insG |
| 14 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449933.1 | 87% | 86.9% | (many diffs) |
| 15 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720545.4 | 86.3% | 86.1% | (many diffs) |
| 16 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320135.1 | 74.5% | 74.3% | (many diffs) |
| 17 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001007156.2 | 71.1% | 65.3% | (many diffs) |
| 18 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_011521637.3 | 71% | 65.3% | (many diffs) |
| 19 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449934.1 | 71% | 65.3% | (many diffs) |
| 20 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022247.2 | 70.1% | 64.2% | (many diffs) |
| 21 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | NM_001320134.1 | 67.2% | 64.6% | (many diffs) |
| 22 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022248.2 | 66.2% | 63.5% | (many diffs) |
| 23 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449935.1 | 65.8% | 64.1% | (many diffs) |
| 24 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720548.4 | 63.9% | 63.9% | 678C>T;1584_1585ins892 |
| 25 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_024449936.1 | 59.2% | 53.6% | (many diffs) |
| 26 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720549.4 | 59.1% | 55% | (many diffs) |
| 27 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_006720550.4 | 58.2% | 54% | (many diffs) |
| 28 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022250.2 | 56.9% | 56.7% | (many diffs) |
| 29 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_011521638.3 | 56.6% | 56.4% | (many diffs) |
| 30 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751293.2 | 52.9% | (many diffs) | |
| 31 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022251.2 | 52.6% | 51.6% | (many diffs) |
| 32 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_002957645.1 | 51.9% | (many diffs) | |
| 33 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XM_017022252.2 | 51.8% | 49.6% | (many diffs) |
| 34 | human | 4916 | NTRK3 | neurotrophic receptor tyros... | XR_001751292.2 | 15.2% | 1_643del;1321C>T;3119_16213delinsG | |
| 35 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_008746.5 | 91% | 97% | (many diffs) |
| 36 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250817.2 | 89.5% | 95.4% | (many diffs) |
| 37 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540691.3 | 88.3% | 94.2% | (many diffs) |
| 38 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_011250816.2 | 86.9% | 92.7% | (many diffs) |
| 39 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | NM_182809.2 | 64.1% | 62.4% | (many diffs) |
| 40 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_006540692.3 | 61% | 61.8% | (many diffs) |
| 41 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XM_017322023.1 | 59.9% | 61.6% | (many diffs) |
| 42 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785487.1 | 31.7% | (many diffs) | |
| 43 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785488.1 | 30.5% | (many diffs) | |
| 44 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882023.2 | 27% | (many diffs) | |
| 45 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882022.2 | 16.9% | (many diffs) | |
| 46 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_001785486.1 | 16.6% | (many diffs) | |
| 47 | mouse | 18213 | Ntrk3 | neurotrophic tyrosine kinas... | XR_882025.2 | 15.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 2553
- ORF length:
- 2478
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggat gtctctcttt gcccagccaa gtgtagtttc tggcggattt 121 tcttgctggg aagcgtctgg ctggactatg tgggctccgt gctggcttgc cctgcaaatt 181 gtgtctgcag caagactgag atcaattgcc ggcggccgga cgatgggaac ctcttccccc 241 tcctggaagg gcaggattca gggaacagca atgggaacgc cagtatcaac atcacggaca 301 tctcaaggaa tatcacttcc atacacatag agaactggcg cagtcttcac acgctcaacg 361 ccgtggacat ggagctctac accggacttc aaaagctgac catcaagaac tcaggacttc 421 ggagcattca gcccagagcc tttgccaaga acccccattt gcgttatata aacctgtcaa 481 gtaaccggct caccacactc tcgtggcagc tcttccagac gctgagtctt cgggaattgc 541 agttggagca gaactttttc aactgcagct gtgacatccg ctggatgcag ctctggcagg 601 agcaggggga ggccaagctc aacagccaga acctctactg catcaacgct gatggctccc 661 agcttcctct cttccgcatg aacatcagtc agtgtgacct tcctgagatc agcgtgagcc 721 acgtcaacct gaccgtacga gagggtgaca atgctgttat cacttgcaat ggctctggat 781 caccccttcc tgatgtggac tggatagtca ctgggctgca gtccatcaac actcaccaga 841 ccaatctgaa ctggaccaat gttcatgcca tcaacttgac gctggtgaat gtgacgagtg 901 aggacaatgg cttcaccctg acgtgcattg cagagaacgt ggtgggcatg agcaatgcca 961 gtgttgccct cactgtctac tatcccccac gtgtggtgag cctggaggag cctgagctgc 1021 gcctggagca ctgcatcgag tttgtggtgc gtggcaaccc cccaccaacg ctgcactggc 1081 tgcacaatgg gcagcctctg cgggagtcca agatcatcca tgtggaatac taccaagagg 1141 gagagatttc cgagggctgc ctgctcttca acaagcccac ccactacaac aatggcaact 1201 ataccctcat tgccaaaaac ccactgggca cagccaacca gaccatcaat ggccacttcc 1261 tcaaggagcc ctttccagag agcacggata actttatctt gtttgacgaa gtgagtccca 1321 cacctcctat cactgtgacc cacaaaccag aagaagacac ttttggggta tccatagcag 1381 ttggacttgc tgcttttgcc tgtgtcctgt tggtggttct cttcgtcatg atcaacaaat 1441 atggtcgacg gtccaaattt ggaatgaagg gtcccgtggc tgtcatcagt ggtgaggagg 1501 actcagccag cccactgcac cacatcaacc acggcatcac cacgccctcg tcactggatg 1561 ccgggcccga cactgtggtc attggcatga ctcgcatccc tgtcattgag aacccccagt 1621 acttccgtca gggacacaac tgccacaagc cggacacgta tgtgcagcac attaagagga 1681 gagacatcgt gctgaagcga gaactgggtg agggagcctt tggaaaggtc ttcctggccg 1741 agtgctacaa cctcagcccg accaaggaca agatgcttgt ggctgtgaag gccctgaagg 1801 atcccaccct ggctgcccgg aaggatttcc agagggaggc cgagctgctc accaacctgc 1861 agcatgagca cattgtcaag ttctatggag tgtgcggcga tggggacccc ctcatcatgg 1921 tctttgaata catgaagcat ggagacctga ataagttcct cagggcccat gggccagatg 1981 caatgatcct tgtggatgga cagccacgcc aggccaaggg tgagctgggg ctctcccaaa 2041 tgctccacat tgccagtcag atcgcctcgg gtatggtgta cctggcctcc cagcactttg 2101 tgcaccgaga cctggccacc aggaactgcc tggttggagc gaatctgcta gtgaagattg 2161 gggacttcgg catgtccaga gatgtctaca gcacggatta ttacagggtg ggaggacaca 2221 ccatgctccc cattcgctGG ATGCCTCCTG AAAGCATCAT GTACCGGAAG TTCACTACAG 2281 AGAGTGATGT ATGGAGCTTC GGGGTGATCC TCTGGGAGAT CTTCACCTAT GGAAAGCAGC 2341 CATGGTTCCA ACTCTCAAAC ACGGAGGTCA TTGAGTGCAT TACCCAAGGT CGTGTTTTGG 2401 AGCGGCCCCG AGTCTGCCCC AAAGAGGTGT ACGATGTCAT GCTGGGGTGC TGGCAGAGGG 2461 AACCACAGCA GCGGTTGAAC ATCAAGGAGA TCTACAAAAT CCTCCATGCT TTGGGGAAGG 2521 CCACCCCAAT CTACCTGGAC ATTCTTGGCG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 2581 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2641 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACCGAA 2701 ACTCTCCGAG AGGCGTCATA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2761 tgaaagatt