Construct: ORF TRCN0000491655
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021876.2_s317c1
- DNA Barcode:
- TAAACGACGTTATACGACACTCGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- HDAC3 (8841)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491655
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8841 | HDAC3 | histone deacetylase 3 | NM_003883.4 | 99.9% | 100% | 165A>G |
| 2 | human | 8841 | HDAC3 | histone deacetylase 3 | NM_001355039.2 | 96% | 92.1% | (many diffs) |
| 3 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149167.2 | 72.4% | (many diffs) | |
| 4 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149168.1 | 65.1% | (many diffs) | |
| 5 | human | 8841 | HDAC3 | histone deacetylase 3 | NM_001355040.1 | 64.2% | 63% | 0_1ins403;17_18ins56 |
| 6 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149164.1 | 61.8% | (many diffs) | |
| 7 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149169.1 | 61% | (many diffs) | |
| 8 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149165.1 | 57.9% | (many diffs) | |
| 9 | human | 8841 | HDAC3 | histone deacetylase 3 | NM_001355041.1 | 56.3% | 56.3% | 0_1ins561 |
| 10 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149166.1 | 55.6% | (many diffs) | |
| 11 | mouse | 15183 | Hdac3 | histone deacetylase 3 | NM_010411.2 | 92.4% | 99.7% | (many diffs) |
| 12 | mouse | 15183 | Hdac3 | histone deacetylase 3 | XR_385976.3 | 58.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1353
- ORF length:
- 1284
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggccaagacc gtggcctatt tctacgaccc cgacgtgggc aacttccact 121 acggagctgg acaccctatg aagccccatc gcctggcatt gacccatagc ctggtcctgc 181 attacggtct ctataagaag atgatcgtct tcaagccata ccaggcctcc cagcatgaca 241 tgtgccgctt ccactccgag gactacattg acttcctgca gagagtcagc cccaccaata 301 tgcaaggctt caccaagagt cttaatgcct tcaacgtagg cgatgactgc ccagtgtttc 361 ccgggctctt tgagttctgc tcgcgttaca caggcgcatc tctgcaagga gcaacccagc 421 tgaacaacaa gatctgtgat attgccatta actgggctgg tggtctgcac catgccaaga 481 agtttgaggc ctctggcttc tgctatgtca acgacattgt gattggcatc ctggagctgc 541 tcaagtacca ccctcgggtg ctctacattg acattgacat ccaccatggt gacggggttc 601 aagaagcttt ctacctcact gaccgggtca tgacggtgtc cttccacaaa tacggaaatt 661 acttcttccc tggcacaggt gacatgtatg aagtcggggc agagagtggc cgctactact 721 gtctgaacgt gcccctgcgg gatggcattg atgaccagag ttacaagcac cttttccagc 781 cggttatcaa ccaggtagtg gacttctacc aacccacgtg cattgtgctc cagtgtggag 841 ctgactctct gggctgtgat cgattgggct gctttaacct cagcatccga gggcatgggg 901 aatgcgttga atatgtcaag agcttcaata tccctctact cgtgctgggt ggtggtggtt 961 atactgtccg aaatgttgcc cgctgctgga catatgagac atcgctgctg gtagaagagg 1021 ccattagtga ggagcttccc tatagtgaat acttcgagta ctttgcccca gacttcacac 1081 ttcatccaga tgtcagcacc cgcatcgaga atcagaactc acgccagtat ctggaccaga 1141 tccgccagac aatctttgaa aacctgaaga tgctgaacca tgcaccTAGT GTCCAGATTC 1201 ATGACGTGCC TGCAGACCTC CTGACCTATG ACAGGACTGA TGAGGCTGAT GCAGAGGAGA 1261 GGGGTCCTGA GGAGAACTAT AGCAGGCCAG AGGCACCCAA TGAGTTCTAT GATGGAGACC 1321 ATGACAATGA CAAGGAAAGC GATGTGGAGA TTTAGAACCC AGCTTTCTTG TACAAAGTGG 1381 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1441 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1501 ATAAACGACG TTATACGACA CTCGAACGCG TTAAGTCgac aatcaacctc tggattacaa 1561 aatttgtgaa agatt