Construct: ORF TRCN0000491685
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005877.3_s317c1
- Derived from:
- ccsbBroadEn_14890
- DNA Barcode:
- AATACTGGCACCGAGAATTCATAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NME5 (8382)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491685
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8382 | NME5 | NME/NM23 family member 5 | NM_003551.3 | 100% | 100% | |
| 2 | human | 8382 | NME5 | NME/NM23 family member 5 | XM_017009945.2 | 72.4% | 67.9% | (many diffs) |
| 3 | human | 8382 | NME5 | NME/NM23 family member 5 | XM_024446227.1 | 72.4% | 67.9% | (many diffs) |
| 4 | human | 8382 | NME5 | NME/NM23 family member 5 | XM_024446228.1 | 69.8% | 68.3% | (many diffs) |
| 5 | human | 8382 | NME5 | NME/NM23 family member 5 | XM_005272099.2 | 69.4% | 68.3% | 437A>T;440_440delAinsTT;444_445ins191 |
| 6 | mouse | 75533 | Nme5 | NME/NM23 family member 5 | NM_080637.3 | 83.3% | 85.8% | (many diffs) |
| 7 | mouse | 75533 | Nme5 | NME/NM23 family member 5 | XM_017318004.1 | 83.3% | 85.8% | (many diffs) |
| 8 | mouse | 75533 | Nme5 | NME/NM23 family member 5 | XM_006526319.2 | 75.1% | 72.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 702
- ORF length:
- 636
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gatatcaatg cctccacctc agatatatgt agaaaaaact ctggccatta 121 tcaaaccaga tattgttgac aaagaggagg agatacaaga tattattctt agatccggat 181 tcaccattgt tcagagaaga aaactacgcc tcagccctga gcaatgtagt aacttttatg 241 tggaaaagta tggaaaaatg tttttcccca acttaacagc ttacatgagt tctggaccac 301 ttgtcgccat gatattagct agacataaag ccatctctta ttggttagaa cttttgggac 361 caaataatag cttagtagcg aaggagacac atccagacag tctgagggca atttatggca 421 cagatgaccT AAGGAATGCA CTTCATGGGA GTAATGACTT TGCTGCTGCG GAAAGAGAAA 481 TACGTTTTAT GTTTCCTGAA GTGATTGTTG AGCCCATTCC AATTGGACAA GCTGCTAAGG 541 ACTATTTAAA TTTACATATA ATGCCAACTC TGCTTGAAGG ACTCACAGAG CTTTGTAAGC 601 AAAAACCAGC AGATCCTTTG ATTTGGCTAG CTGATTGGCT GCTGAAAAAT AATCCTAACA 661 AACCCAAACT TTGTCACCAT CCAATTGTAG AAGAACCTTA TTACCCAACT TTCTTGTACA 721 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 781 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 841 AGGACGAAAT ACTGGCACCG AGAATTCATA AACGCGTTAA GTCgacaatc aacctctgga 901 ttacaaaatt tgtgaaagat t