Transcript: Human XM_024446228.1

PREDICTED: Homo sapiens NME/NM23 family member 5 (NME5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NME5 (8382)
Length:
1129
CDS:
107..556

Additional Resources:

NCBI RefSeq record:
XM_024446228.1
NBCI Gene record:
NME5 (8382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446228.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006176 GCCATGATATTAGCTAGACAT pLKO.1 347 CDS 100% 4.950 6.930 N NME5 n/a
2 TRCN0000356563 CATGATATTAGCTAGACATAA pLKO_005 349 CDS 100% 13.200 10.560 N NME5 n/a
3 TRCN0000356488 GACAGTCTGAGGGCAATTTAT pLKO_005 437 CDS 100% 15.000 10.500 N NME5 n/a
4 TRCN0000356486 CCATTATCAAACCAGATATTG pLKO_005 156 CDS 100% 13.200 9.240 N NME5 n/a
5 TRCN0000006174 GCCATTATCAAACCAGATATT pLKO.1 155 CDS 100% 13.200 9.240 N NME5 n/a
6 TRCN0000356487 TATAGGCTTAGAGTATGATTT pLKO_005 803 3UTR 100% 13.200 9.240 N NME5 n/a
7 TRCN0000006173 GCTGTACTTCTACTGTTTGAA pLKO.1 675 3UTR 100% 5.625 3.938 N NME5 n/a
8 TRCN0000006175 CCAAACTTTGTCACCATCCAA pLKO.1 586 3UTR 100% 3.000 2.100 N NME5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446228.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01918 pDONR223 100% 69.8% 68.3% None (many diffs) n/a
2 ccsbBroad304_01918 pLX_304 0% 69.8% 68.3% V5 (many diffs) n/a
3 TRCN0000466197 GTTTCGTTATTGTGGGATGTGTTC pLX_317 48.7% 69.8% 68.3% V5 (many diffs) n/a
4 ccsbBroadEn_14890 pDONR223 0% 69.8% 68.3% None (many diffs) n/a
5 ccsbBroad304_14890 pLX_304 0% 69.8% 68.3% V5 (many diffs) n/a
6 TRCN0000491685 AATACTGGCACCGAGAATTCATAA pLX_317 43.1% 69.8% 68.3% V5 (many diffs) n/a
7 TRCN0000489156 ACCAGTCTCTATTACCGGTCTAAT pLX_317 56.8% 69.8% 68.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV