Transcript: Mouse XM_006526319.2

PREDICTED: Mus musculus NME/NM23 family member 5 (Nme5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nme5 (75533)
Length:
963
CDS:
158..751

Additional Resources:

NCBI RefSeq record:
XM_006526319.2
NBCI Gene record:
Nme5 (75533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360528 ATGTTTCCAGCCGTGATTATT pLKO_005 581 CDS 100% 15.000 21.000 N Nme5 n/a
2 TRCN0000024597 GCTATGATATTAGCTAGACAT pLKO.1 398 CDS 100% 4.950 6.930 N Nme5 n/a
3 TRCN0000024594 GCCGTGATTATTGAACCCATT pLKO.1 590 CDS 100% 4.050 5.670 N Nme5 n/a
4 TRCN0000360527 GGATCTGGATTCACCATTATT pLKO_005 263 CDS 100% 15.000 10.500 N Nme5 n/a
5 TRCN0000360529 CCAAACTTAACAGCTTATATG pLKO_005 359 CDS 100% 13.200 9.240 N Nme5 n/a
6 TRCN0000024598 CCCGAGCACTGTAGTAACTTT pLKO.1 308 CDS 100% 5.625 3.938 N Nme5 n/a
7 TRCN0000024596 GCCCTTATCAAGCCAGATGTT pLKO.1 206 CDS 100% 4.950 3.465 N Nme5 n/a
8 TRCN0000024595 GCGAGAGATCAGGTTCATGTT pLKO.1 565 CDS 100% 4.950 3.465 N Nme5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01918 pDONR223 100% 75.1% 72.1% None (many diffs) n/a
2 ccsbBroad304_01918 pLX_304 0% 75.1% 72.1% V5 (many diffs) n/a
3 TRCN0000466197 GTTTCGTTATTGTGGGATGTGTTC pLX_317 48.7% 75.1% 72.1% V5 (many diffs) n/a
4 ccsbBroadEn_14890 pDONR223 0% 75.1% 72.1% None (many diffs) n/a
5 ccsbBroad304_14890 pLX_304 0% 75.1% 72.1% V5 (many diffs) n/a
6 TRCN0000491685 AATACTGGCACCGAGAATTCATAA pLX_317 43.1% 75.1% 72.1% V5 (many diffs) n/a
7 TRCN0000489156 ACCAGTCTCTATTACCGGTCTAAT pLX_317 56.8% 75.1% 72.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV