Construct: ORF TRCN0000491714
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014613.1_s317c1
- Derived from:
- ccsbBroadEn_00779
- DNA Barcode:
- CGGTACTGCTATATAAGCTATTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HOXD4 (3233)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491714
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3233 | HOXD4 | homeobox D4 | NM_014621.3 | 100% | 100% | |
| 2 | human | 3233 | HOXD4 | homeobox D4 | XM_005246514.4 | 56.8% | 56.4% | 434_435delGTinsTG;437T>A;438_439ins327 |
| 3 | mouse | 15436 | Hoxd4 | homeobox D4 | NM_010469.2 | 88.1% | 91.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 831
- ORF length:
- 765
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt catgagttcg tatatggtga actccaagta tgtggacccc aagttccctc 121 cgtgcgagga gtatttgcag ggcggctacc taggcgagca gggcgccgac tactacggcg 181 gcggcgcgca gggcgcagac ttccagcccc cggggctcta cccacggccc gacttcggtg 241 agcagccttt cggaggcagc ggccccgggc ctggctcggc gctgcctgcg cggggtcacg 301 gacaagagcc aggcggcccc ggcggtcact acgccgctcc aggagagcct tgcccagctc 361 ccccggcgcc tccgccggcg cccctgcctg gcgcccgggc ctacagtcag tccgacccca 421 agcagccgcc ctccgggacg gcactcaagc agccggccgt ggtctacccc tggatgaaga 481 agGTGCACGT GAATTCGGTG AACCCCAACT ACACCGGTGG GGAACCCAAG CGGTCCCGAA 541 CGGCCTACAC CCGGCAGCAA GTCCTAGAAC TGGAAAAAGA ATTTCATTTT AACAGGTATC 601 TGACAAGGCG CCGTCGGATT GAAATCGCTC ACACCCTGTG TCTGTCGGAG CGCCAGATCA 661 AGATCTGGTT CCAGAACCGG AGGATGAAGT GGAAAAAAGA TCATAAGCTG CCCAACACTA 721 AAGGCAGGTC ATCGTCCTCA TCTTCCTCCT CATCTTGCTC CTCCTCAGTC GCCCCCAGCC 781 AGCATTTACA GCCGATGGCC AAAGACCACC ACACGGACCT GACGACCTTA TACCCAACTT 841 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 901 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 961 CTTGTGGAAA GGACGACGGT ACTGCTATAT AAGCTATTTT ACGCGTTAAG TCgacaatca 1021 acctctggat tacaaaattt gtgaaagatt