Transcript: Human XM_005246514.4

PREDICTED: Homo sapiens homeobox D4 (HOXD4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HOXD4 (3233)
Length:
5047
CDS:
1241..1681

Additional Resources:

NCBI RefSeq record:
XM_005246514.4
NBCI Gene record:
HOXD4 (3233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246514.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353626 ACGGACCTGACGACCTTATAG pLKO_005 1891 3UTR 100% 13.200 18.480 N HOXD4 n/a
2 TRCN0000019938 CACGGACCTGACGACCTTATA pLKO.1 1890 3UTR 100% 13.200 18.480 N HOXD4 n/a
3 TRCN0000329722 TCGGATTGAAATCGCTCACAC pLKO_005 1692 3UTR 100% 4.050 5.670 N HOXD4 n/a
4 TRCN0000019934 GCCCTCGGACTAGGTTAGCAT pLKO.1 2039 3UTR 100% 1.000 1.400 N HOXD4 n/a
5 TRCN0000329782 CATAAGCTGCCCAACACTAAA pLKO_005 1780 3UTR 100% 13.200 9.240 N HOXD4 n/a
6 TRCN0000019937 CCCTCCGTGCGAGGAGTATTT pLKO.1 1291 CDS 100% 4.400 3.080 N HOXD4 n/a
7 TRCN0000353571 CCTCCGTGCGAGGAGTATTTG pLKO_005 1292 CDS 100% 4.400 3.080 N HOXD4 n/a
8 TRCN0000019935 CCAACACTAAAGGCAGGTCAT pLKO.1 1790 3UTR 100% 4.050 2.835 N HOXD4 n/a
9 TRCN0000019936 GTCGGATTGAAATCGCTCACA pLKO.1 1691 3UTR 100% 2.640 1.848 N HOXD4 n/a
10 TRCN0000329724 ATGAAGAAGGTGCACGTGAAT pLKO_005 1649 CDS 100% 4.950 2.970 N HOXD4 n/a
11 TRCN0000428137 GATCAAGATCTGGTTCCAGAA pLKO_005 1734 3UTR 100% 4.050 2.025 Y Hoxa3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246514.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00779 pDONR223 100% 56.8% 56.4% None 434_435delGTinsTG;437T>A;438_439ins327 n/a
2 ccsbBroad304_00779 pLX_304 0% 56.8% 56.4% V5 434_435delGTinsTG;437T>A;438_439ins327 n/a
3 TRCN0000491714 CGGTACTGCTATATAAGCTATTTT pLX_317 45.7% 56.8% 56.4% V5 434_435delGTinsTG;437T>A;438_439ins327 n/a
Download CSV